We narrowed to 13,228 results for: sequence
-
Plasmid#212627PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-2xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-12xMS2
Plasmid#212628PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-12xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-4xMS2
Plasmid#212626PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-4xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMAT_CD28ICD
Plasmid#197098PurposeThis plasmid contains the coding sequence for the intracellular domain of CD28. Digest this insert and add it to pHR_pSFFV_scFVCD19_CD8a_CD3zP2AEGFPDepositorInsertThis plasmid contains the coding sequence for the intracellular domain of CD28.
ExpressionMammalianAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGG-GTS-TurboID
Plasmid#209397PurposeTransiently expressing TurboID fused with a Golgi targeting sequence (GTS) in plantaDepositorInsertGTS-3XHA-TurboID
ExpressionPlantMutationTurboID gene sequence C249APromoterCauliflower mosaic virus (CaMV) 35S promoterAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR2_IRdist_scram
Plasmid#162319PurposeP. aeruginosa PA14 CRISPR2 locus, with a scrambled distal Inverted Repeat of the upstream motifDepositorInsertPseudomonas aeruginosa PA14 CRISPR2 locus
ExpressionBacterialMutationThe distal Upstream Motif site is scrambledPromoterpBADAvailable SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pASPIre4
Plasmid#196656PurposeDerivative of pASPIre3. Contains SpeI restriction site within the CDS of bxb1 to enable diversification of the 5’-UTR and codons 2-16.DepositorInsertBxb1-sfGFP fusion controlled by rhamnose promoter; attB/attP-flanked discriminator; exchangable 5'-UTR and CDS (codons 1-16)
ExpressionBacterialMutationSpeI site in Bxb1 CDSPromoterrhamnose-inducible promoterAvailable SinceAug. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
TEG +Q111T
Plasmid#187435PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cellsDepositorInsertsATP1A1
ATP1B1
ExpressionInsectMutationchanged glutamine at 117 to threoninePromoterPH and p10Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEM.F02R
Plasmid#198662PurposeEasy-MISE toolkit pEM-plasmid containing GFP coding sequence preceded by a linker sequence with HI protruding endsDepositorInsertlinker+GFP
UseSynthetic BiologyExpressionYeastAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only