We narrowed to 17,580 results for: IGH@
-
Plasmid#195725PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#11 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F16
Plasmid#195730PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#16 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F18
Plasmid#195732PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#18 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F1
Plasmid#195715PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#1 of a 24 fragment split in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F9
Plasmid#195723PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#9 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F23
Plasmid#195737PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#23 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F21
Plasmid#195735PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#21 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
TTR C10S E63C
Plasmid#190009PurposeExpression of human TTR in E coliDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-MAVS-mTA3
Plasmid#171001PurposeHiLITR protease with MAVS [Y536delinsFIV] C-terminal tmd targeting information (Mitochondria and ER insertion)DepositorInsertEGFP-uTEV1-MAVS(tmd)[Y536delinsFIV]
UseLentiviral and Synthetic BiologyExpressionMammalianMutationMAVS(tmd)[Y536delinsFIV]PromoterpTRE-tight (TetOn)Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
HeFm1SpCas9
Plasmid#92110PurposeExpression plasmid for human codon-optimized increased fidelity HeFm1SpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity mut1 Cas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationR661A, Q695A, K848A, Q926A, K1003A, R1060APromoterCbhAvailable SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
SMR3B-bio-His
Plasmid#52183PurposeExpresses full-length Submaxillary gland androgen-regulated protein 3B precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertSMR3B (SMR3B Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
prhaBAD-anti-mouse-Nb-Hia5
Plasmid#239626PurposeRhamnose inducible expression plasmid for anti-mouse nanobody fusion to Hia5 DNA adenine methyltransferaseDepositorInsertHia5
Tags6HIS, MBP, TEV, and anti-Mouse NanobodyExpressionBacterialMutationCodon optimized for bacterial expressionPromoterrhaBADAvailable SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
HPSE-bio-His
Plasmid#53407PurposeExpresses full-length Heparanase precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertHPSE (HPSE Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4TO-SCN8A-Variant-3-IRES-mScarlet
Plasmid#209411PurposeExpression of wild-type adult isoform of human SCN8A.DepositorInsertSCN8A Variant 3, stabilized (SCN8A Human)
ExpressionMammalianMutationModifed human HSPA5 intron 4 inserted after bp237…PromoterCMVAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
NOTCH3-bio-His
Plasmid#53343PurposeExpresses full-length Neurogenic locus notch homolog protein 3 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertNOTCH3 (NOTCH3 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
prhaBAD-pA-Hia5
Plasmid#222303PurposePlasmid for rhamnose inducible expression and purification of protein A-Hia5-6XHis (pA-Hia5) for antibody directed DNA (adenine) methylation (as in DiMeLo-seq)DepositorInsertpA-Hia5
Tags6His and protein AExpressionBacterialMutationcodon optimized for bacterial expressionPromoterrhaBADAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCMV-TM-KA2-CaM-NES-TevN-AsLOV2-TEVseq-tTA
Plasmid#171617PurposeAAV Soma-targeted Cal-Light with KA2DepositorInsertTM-KA2-CaM-NES-TevN-AsLOV2-TEVseq-tTA
UseAAV and Synthetic BiologyTagsMycExpressionMammalianPromoterCMVAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
EFNB1-bio-His
Plasmid#51749PurposeExpresses full-length Ephrin-B1 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertEFNB1 (EFNB1 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-mCherry-p2A-full length LIC1
Plasmid#74601Purposeexpresses LIC1 in mammalian cells; untagged but cells indicate expression with diffuse mCherryDepositorInsertfull length human dynein light intermediate chain 1 (DYNC1LI1 Human)
UseLentiviralExpressionMammalianPromoterSFFVAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only