We narrowed to 4,010 results for: SPL;
-
Plasmid#235094PurposeLbr mCherry fusion protein without MCP domainDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pSLED.NPL
Plasmid#193014PurposeNeuron-specific reporter (CBh promoter, Pls3 exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
AR-V7-pcw107-V5
Plasmid#64636Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertAR (transcript variant 1, splice isoform) (AR Human)
UseLentiviralTagsV5Mutationsplice isoform *PromoterPGKAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR207 SARS-CoV-2 NSP1 Delta RC
Plasmid#164522PurposeGateway-compatible Entry vector, with insert of mutated NSP1 CDS from SARS-CoV-2 isolate Wuhan-Hu-1 (amino acid substitutions K164A/H165A)DepositorInsertNSP1 Delta RC (ORF1ab )
ExpressionMammalianMutationInsert of NSP1 gene's CDS from SARS-CoV-2 is…Available SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLED.GluA2
Plasmid#193017PurposeGluA2 (Gria2) flip/flop reporter (hSyn promoter, Gria2 flip/flop exons, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLED.ENS
Plasmid#193016PurposeExcitatory neuron-specific reporter (hSyn promoter, Synrg exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-NTID194-GSQ-PMLiva3MAS-P2A-BLAST
Plasmid#208039PurposeEnables constitutive expression of N-terminal Split-TurboID-fused PML (isoform IVa; 3MAS mutant; K>R sumoylation sites, mutated SIM); selection with blasticidinDepositorInsertPML (isoform IVa; 3MAS) (PML Human)
UseLentiviralTagsFLAG, N-terminal Split-TurboIDMutation3MAS mutant: K65R, K160R and K490R; mutated SIMPromoterEFSAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
anti-Jagged_D5-pBIOCAM5
Plasmid#39345DepositorAvailable SinceOct. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTT3-ecdCD86-ST3-His
Plasmid#210664PurposeExpression of the extracellular domain of human CD86 fused to Spytag003 + Histag in HEK293 (or similar)DepositorInsertExtracellular domain of human CD86 fused to Spytag003 and Histag (CD86 Human)
TagsHistag and Spytag003ExpressionMammalianPromoterCMVAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC23A2_STOP
Plasmid#161191PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC23A2 (SLC23A2 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGL3E-hGPR56 e1m promoter normal
Plasmid#52298PurposeReporter for normal human GPR56 exon 1m promoter activity. Human GPR56 e1m promoter (chr16:56,230,630-56,230,943 (hg18)) was inserted into pGL3E.DepositorInsertADGRG1 adhesion G protein-coupled receptor G1 (ADGRG1 Human)
UseLuciferaseAvailable SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR207 SARS-CoV-2 NSP1 124A/125A
Plasmid#164523PurposeGateway-compatible Entry vector, with insert of mutated NSP1 CDS from SARS-CoV-2 isolate Wuhan-Hu-1 (amino acid substitutions R124A/K125A)DepositorInsertNSP1 124A/125A (ORF1ab )
ExpressionMammalianMutationInsert of NSP1 gene's CDS from SARS-CoV-2 is…Available SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3E-hGPR56 e1m promoter perisylvian polymicrogyria
Plasmid#52299PurposeReporter for mutated human GPR56 exon 1m promoter activity. It contains a 15-bp deletion in a conserved noncoding element. The mutated human GPR56 e1m promoter was inserted into pGL3E.DepositorInsertADGRG1 adhesion G protein-coupled receptor G1 (ADGRG1 Human)
UseLuciferaseMutation15-bp deletion in the promoterPromoterHuman GPR56 e1m promoterAvailable SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MCP-Lbr-V5-mCherry
Plasmid#235093PurposeLbr mCherry fusion protein with MCP domainDepositorAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTT3-ecdCD80-ST3-His
Plasmid#210665PurposeExpression of the extracellular domain of human CD80 fused to Spytag003 + Histag in HEK293 (or similar)DepositorInsertExtracellular domain of human CD80 fused to Spytag003 and Histag (CD80 Human)
TagsHistag and Spytag003ExpressionMammalianPromoterCMVAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
TR01F/hFGFR3-G380R-V5
Plasmid#214908Purposefor PiggyBac mediated integration and stable expression of hFGFR3-G380R variant that is associated with AchondroplasiaDepositorInsertFGFR3 (FGFR3 Human)
TagsV5/HisExpressionMammalianMutationG380R substitutionPromotertruncated CMV promoterAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLED.CaRPv1
Plasmid#193018PurposeExcitatory/Inhibitory neuron calcium indicator (hSyn promoter, Synrg exon, jRGECO1a/jGCaMP7b)DepositorInsertBichromatic calcium indicator (jGCaMP7b and jRGECO1a)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only