We narrowed to 7,382 results for: PAC
-
Plasmid#197888PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVTagsExpressionMutationN/APromoterCAGAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(285)-GFP
Plasmid#197889PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVTagsExpressionMutationN/APromoterCAGAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGG198
Plasmid#165605PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with two hEGFP protospacers: PS1(upstream of promoter with 'CAGCG' PAM)-lac-PS2(downstream with 'CGGCG' PAM)-HIS3 and GFPDepositorInserthEGFP protospacer ('CGGCG' PAM) downstream of the HIS3/GFP promoter
UseSynthetic BiologyTagsExpressionBacterialMutationSecondary protospacer ('CGGCG' PAM) ins…PromoterlacAvailable sinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1
Plasmid#218796PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG9A-mCherry
Plasmid#197393PurposeExpresses ATG9A in mammalian cellsDepositorInsertATG9A (ATG9A Human)
UseTagsmChExpressionMammalianMutationPromoterAvailable sinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-2NLS-Cas9-6XMS2
Plasmid#166033PurposeExpression of 6X MS2 stem loops fused SpCas9 mRNA for packaging of SpCas9 mRNA within lentiviral particles.DepositorInsertSpCas9
UseCRISPR and LentiviralTagsExpressionMutationPromoterCMVAvailable sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI30
Plasmid#183749PurposeAAV-BI30 Rep-Cap plasmid for production of AAV-BI30, a capsid with tropism for CNS endothelial cells.DepositorInsertAAV9 modified with 7mer insertion between amino acids 588 and 589 of VP1
UseAAVTagsExpressionMutationK449R, and NNSTRGG inserted between 588 and 589 o…Promoterp41Available sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS hygro
Plasmid#158634PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS constructDepositorInsertMAVS (MAVS Human)
UseLentiviralTags3XFLAGExpressionMutationPromoterAvailable sinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1-2
Plasmid#218797PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1-2
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA GNSTM-3-RVG-10-Lamp2b-HA
Plasmid#71294PurposeEncodes (N to C): GNSTM glycosylation motif, 3 residue spacer, RVG peptide, 10 residue spacer, Lamp2b (exosomal transmembrane protein), 3 residue spacer, HA tag.DepositorInsertLamp2b (LAMP2 Human)
UseTagsGNSTM glycosylation motif, HA, Lamp2 signal pepti…ExpressionMammalianMutationPromoterCMVAvailable sinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBZCas13b
Plasmid#89898PurposeBacterial expression for bzCas13b, driven by the lac promoter, and DR-spacer-DR sequence driven by js23119. New spacer sequences can be cloned in between the DRs by digesting the plasmid with BsaI.DepositorInsertCas13b
UseTagsExpressionBacterialMutationPromoterLacAvailable sinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPbcas13b
Plasmid#89906PurposeBacterial expression for pbCas13b, driven by the lac promoter, and DR-spacer-DR sequence driven by js23119. New spacer sequences can be cloned in between the DRs by digesting the plasmid with BsaI.DepositorInsertCas13b
UseTagsExpressionBacterialMutationPromoterLacAvailable sinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-MAVS
Plasmid#158628PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVSDepositorInsertMAVS (MAVS Human)
UseGateway entry vectorTags3XFLAGExpressionMutationPromoterAvailable sinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1-3
Plasmid#218798PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1-3
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1-4
Plasmid#218799PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1-4
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT310 AAV-BFPdonor
Plasmid#202057PurposeAAV HDR donorDepositorInsertAAV-BFPdonor
UseAAV; Aav packaging plasmidTagsExpressionMammalianMutationITR deletionPromoterAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCas_4(I-U)/1_2_VB
Plasmid#186445PurposeEncodes Cas4/1, Cas2, leader, repeat and one spacer from A. acidoterrestris (type V-B). Cas4 domain swapped with type U-I Cas4 domain from G. sulfurreducensDepositorInsertCas4/1 and Cas2
UseCRISPRTagsExpressionMutationCas4 domain swapped with Cas4 domain from G. sulf…PromoterT7Available sinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBS10-riboE-dddAI
Plasmid#186561PurposeRegulated expression of the DddA immunity determinant (DddAI) in FirmicutesDepositorInsertdddAI
UseTagsExpressionBacterialMutationPromoterpSpac(hy)Available sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2-coHPDL H163A H258A 3xFLAG-V5
Plasmid#174131PurposeExpresses codon-optimized catalytically inactive HPDL with a 3xFlag-V5 tag in mammalian cellsDepositorInsert4-hydroxyphenylpyruvate dioxygenase like (HPDL Human)
UseLentiviralTags3xFLAG-V5ExpressionMammalianMutationCodon optimized, H163A, H258APromoterAvailable sinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only