We narrowed to 13,167 results for: Green Fluorescent Protein
-
Plasmid#133530PurposesfGFP driven by a T7 promoter with the tetO sequence 12 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available sinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.7
Plasmid#133529PurposesfGFP driven by a T7 promoter with the tetO sequence 10 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available sinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.6
Plasmid#133528PurposesfGFP driven by a T7 promoter with the tetO sequence 9 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available sinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.5
Plasmid#133527PurposesfGFP driven by a T7 promoter with the tetO sequence 8 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available sinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.3
Plasmid#133525PurposesfGFP driven by a T7 promoter with the tetO sequence 6 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available sinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.2
Plasmid#133524PurposesfGFP driven by a T7 promoter with the tetO sequence 5 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available sinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.4
Plasmid#133526PurposesfGFP driven by a T7 promoter with the tetO sequence 7 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available sinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY71-tet.I.1
Plasmid#133523PurposesfGFP driven by a T7 promoter with the tetO sequence 4 bp downstream from the promoter start siteDepositorInsertsfGFP
TagsStrep tag and TEV siteExpressionBacterialMutationWTPromoterT7Available sinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCF736
Plasmid#121893PurposeEF1a-dTEV-protease-GFPDepositorInsertsTEV protease
eGFP
UseLentiviralPromoterEF-1a core promoterAvailable sinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHL836
Plasmid#62827PurposeLim Lab plasmid: AmpR + pLlacO-1::ompC::gfp::T1T2 terminator + PLtetO-1::ipex::Asp terminator + PLtetO-1::RBS (st7) hfq::T1 terminator + ColE1DepositorInsertsgfp
ipex leader
hfq leader
UseSynthetic BiologyTagsompC leader and st7 RBSExpressionBacterialPromoterpLlacO-1 and pLtetO-1Available sinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yEPAGFP-CaUra3
Plasmid#44649DepositorInsertyEPAGFP
ExpressionYeastAvailable sinceMay 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBbB1a-GFP
Plasmid#35340DepositorPublicationInsertGFP
UseSynthetic BiologyExpressionBacterialPromoterTrcAvailable sinceMay 16, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CHR2-MBD
Plasmid#21484DepositorInsertChannel Rhodopsin 2 EGFP Myosin Binding Domain
ExpressionMammalianAvailable sinceJune 25, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA5-FRT-TO-FH-eGFP
Plasmid#157734Purposemammalian expression of N-terminally Flag-His8 tagged eGFP under control of a tetracycline-inducible promoterDepositorInsertFH-eGFP
TagsFlag-His8ExpressionMammalianAvailable sinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJF6
Plasmid#139040PurposeMosSCI SapTrap assembly: Cassette 3 for 4-cassette systemDepositorInsertgfp (includes STOP codon, PATC introns)
ExpressionWormAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbB8c-GFP
Plasmid#35362DepositorPublicationInsertGFP
UseSynthetic BiologyExpressionBacterialPromoterBADAvailable sinceMarch 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBbB7c-GFP
Plasmid#35359DepositorPublicationInsertGFP
UseSynthetic BiologyExpressionBacterialPromoterT7Available sinceFeb. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBbB2c-GFP
Plasmid#35344DepositorPublicationInsertGFP
UseSynthetic BiologyExpressionBacterialPromoterTetAvailable sinceFeb. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available sinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP35∆RBS
Plasmid#247214PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available sinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only