-
Plasmid#216213PurposeExpresses GFP and mCD4 transmembrane domain under control of the 2C-specific MERVL promoterDepositorInsertCD4 (Cd4 Mouse)
UseTagsGFP-T2AExpressionMammalianMutationCD4 transmembrane domain onlyPromoterMERVLAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV_dCas9-KRAB_sgSTK3i_#2 (PuroR)
Plasmid#209772PurposeCRISPRi for STK3DepositorInsertdCas9-KRAB, sgSTK3i (STK3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV_dCas9-KRAB_sgSTK3i_#1 (PuroR)
Plasmid#209771PurposeCRISPRi for STK3DepositorInsertdCas9-KRAB, sgSTK3i (STK3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-TALE-R-JAK2-Ddd9-C
Plasmid#204854PurposeFor DdCBE editing using Ddd9 at JAK2 site in human cellsDepositorInsertDdd9-C
UseCRISPRTagsExpressionMammalianMutationPromoterCMVAvailable sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-TALE-L-JAK2-Ddd9-N
Plasmid#204853PurposeFor DdCBE editing using Ddd9 at JAK2 site in human cellsDepositorInsertDdd9-N
UseCRISPRTagsExpressionMammalianMutationPromoterCMVAvailable sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
K365-iLid
Plasmid#188456PurposeComponent of optically-induced motor dimerization systemDepositorInsertKinesin 1-365 (Khc Fly)
UseTags6xHis and iLidExpressionBacterialMutationKinesin amino acids 1-365PromoterT7Available sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
K365-micro
Plasmid#188457PurposeComponent of optically-induced motor dimerization systemDepositorInsertKinesin 1-365 (Khc Fly)
UseTags6xHis-MBP-TEV and SspB microExpressionBacterialMutationKinesin amino acids 1-365PromoterT7Available sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEJS1831 All-in-one AAV-U1a-NmeABE-8e-2xBPSV40-miniU6-Fah
Plasmid#199264PurposeSingle AAV vector for expressing N-terminal fusion Nme2Cas9-ABE8e and one miniU6 driven sgRNA targeting the point mutation in the mouse Fah gene of a HT1 mouse modelDepositorInsertNmeABE8e
UseAAV and CRISPRTagsNLSExpressionMammalianMutationPromoterAvailable sinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
HT114_Fsyn_FAS(Cre off)_QuasAr6b_Citrine
Plasmid#178825PurposeNeuronal expression (Cre-off) of an archaerhodopsin-derived genetically encoded voltage indicator QuasAr6b carrying a Citrine expression tagDepositorInsertQuasAr6b_citrine
UseCre/Lox and LentiviralTagscitrineExpressionMammalianMutationPromoterhSynAvailable sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
p5xQUAS-ZsGreen-P2A, α-cry:mCherry
Plasmid#180477PurposeInducible gene expression vector p5xQUAS-ZsGreen-P2A, α-cry:mCherryDepositorInserts5x QUAS-ZsGreen-P2A
mCherry
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-Ef1A-Myc-POLB(PAMmut)
Plasmid#176150PurposeN-terminus Myc-tagged POLB containing a mutation in the PAM site used by POLB gRNA1 & a hygromycin resistance cassetteDepositorInsertPolB (POLB Human)
UseLentiviralTagsMYCExpressionMammalianMutationMutation in the PAM site used by POLB gRNA1PromoterEF1AAvailable sinceFeb. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-EGFP-PolB(K72A)-PAMmut-Hygro
Plasmid#176087PurposeEGFP fused to the N-terminus of POLB containing the mutation Lys72Ala, a mutation in the PAM site used by POLBKOg1 & a hygromycin resistance cassetteDepositorInsertPolB (POLB Human)
UseLentiviralTagsEGFPExpressionMammalianMutationMutation in Lys72 to Ala, and mutation in the PAM…PromoterCMVAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-XL1/BRCT1-Linker-eGFP
Plasmid#176084PurposeEGFP fused to the C-terminus of a XL1/BRCT1 domain & a hygromycin resistance cassetteDepositorInsertXL1/BRCT1 (XRCC1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationPromoterEF1AAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19-POLBHR-eGFP
Plasmid#176064PurposeHomology region +/- 800bp to the transcription start site of POLB, with EGFP inserted in-frame on the N-terminus of POLB, and a mutation in the PAM site used by POLBKO gRNA1 in POLB exon1DepositorInsertEGFP-PolB (POLB Human)
UseTagsEGFPExpressionMammalianMutationpUC with endogenous SapI mutated out, PAM mutatio…PromoterN/AAvailable sinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a-KRAB_crRNA Td2
Plasmid#176261PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged to the KRAB domain and Nlux and crRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseExpressionMutationD917A and E1006A mutations to inactivate the endo…PromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD443
Plasmid#168469PurposeFor the insertion pf NLS-mScarlet-I-H-NSdbd-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mScarlet-I-H-NSdbd-NLS
UseTagsExpressionMammalianMutationPromoterCMV promoterAvailable sinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H171
Plasmid#170353PurposemTurq2Del_EPACdDEPCD_Q270E_cp173Ven(ST)_Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmTurq2Del_EPACdDEPCD_Q270E_cp173Ven(ST)_Ven(ST) (RAPGEF3 Human)
UseAdenoviralTagsExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable sinceOct. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H170
Plasmid#170352PurposemTurq2Del_EPACdDEPCD_cp173Ven(ST)_Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmTurq2Del_EPACdDEPCD_cp173Ven(ST)_Ven(ST) (RAPGEF3 Human)
UseAdenoviralTagsExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable sinceOct. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgRNA-MS2-U6
Plasmid#171694PurposeTo construct expression vector for tBE-V5-mA3DepositorInsertsgRNA scaffold-MS2-U6
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M3_3-pTRNA-scf 2.1 (GB2075)
Plasmid#160560PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M3_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInsertM3_3-pTRNA-scf 2.1
UseCRISPRTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M1_3-pTRNA-scf 2.1 (GB2073)
Plasmid#160558PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M1_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertM1_3-pTRNA-scf 2.1
UseCRISPRTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 Tnos:nptII:Pnos - P35S:Cas9:Tnos - P35S:DsRed:Tnos (GB2234)
Plasmid#160628PurposeModule for the constitutive expression of the nptII, Cas9 and DsRed genes.DepositorInserttNos:nptII:PNos-P35s:Cas9:tNos-P35s:DsRed:tNos
UseCRISPRTagsExpressionMutationBsaI and BsmBI sites removedPromoterPnos, 35S, 35SAvailable sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPGK-T7/2-CD44v2-10 (-cyt)
Plasmid#137825Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v2-10 (-cyt) (CD44 Human)
UseTagsGFPExpressionMammalianMutationwithout cytoplasmic region - N213S on the CD44 re…PromoterPGKAvailable sinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M2_3-pTRNA-scf 2.1 (GB2074)
Plasmid#160559PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M2_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInsertM2_3-pTRNA-scf 2.1
UseCRISPRTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceFeb. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 U6-26-1gRNA-DFR 2.1 (GB1838)
Plasmid#160625PurposeGB-cassette for the expression of a guide RNA targeting the DFR promoter with 2.1 Ms2 aptamer in the 3' of the scaffoldDepositorInsertU6-26-1gRNA-DFR 2.1
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterU6-26Available sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
LB001: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#2 gRNA
Plasmid#131757PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 Sp/xCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterhU6Available sinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LA901: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#1 gRNA
Plasmid#131756PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 Sp/xCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterhU6Available sinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
JV201: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#1 gRNA
Plasmid#131755PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 SaCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterhU6Available sinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LB101: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#2 gRNA
Plasmid#131758PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 SaCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterhU6Available sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Nsp3c_SUD-C
Plasmid#156471PurposeBacterial expression of Sars-CoV2 Nsp3c_SUD-C protein with His-tag and GST-tagDepositorInsertNsp3c_SUD-C (ORF1ab Synthetic)
UseTagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable sinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Nsp3e_NAB
Plasmid#156473PurposeBacterial expression of Sars-CoV2 Nsp3e_NAB protein with His-tag and GST-tagDepositorInsertNsp3e_NAB (ORF1ab Synthetic, Severe acute respiratory syndrome coronavirus 2)
UseTagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable sinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
KA901: pMVP (L3-L2) HA tag + pA; EF1a::eGFP-P2A-TETa-pA
Plasmid#121804PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + EF1a-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream EF1a-driven GFP-P2A-TETaDepositorInsertHA epitope tag-polyA + EF1a::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KA701: pMVP (L3-L2) HA tag + pA; RIP::eGFP-P2A-TETa-pA
Plasmid#121808PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + RIP-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream RIP-driven GFP-P2A-TETaDepositorInsertHA epitope tag-polyA + RIP::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP324-pAAV-FullH1TO-SaCa9sgRNAi(emx1sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113701PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHExpressionMutationPromoterAvailable sinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113699PurposeDox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHExpressionMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-P2A-GFP-PGK-Puro
Plasmid#110862PurposeLentiviral vector for constitutive expression of Cas9-VRER-P2A-GFP (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGExpressionMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1-P2A-GFP-PGK-Puro
Plasmid#110863PurposeLentiviral vector for constitutive expression of Cas9-HF1-P2A-GFP (not codon optimized)DepositorInsertCas9-HF1
UseLentiviralTags3X FLAGExpressionMutationN497A, R661A, Q695A, Q926APromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
HS1BP3-PX (17-139)
Plasmid#119125PurposeBacterial expression of human phox homology (PX) domain, HS1BP3-PX (17-139)DepositorInsertHS1BP3-PX (17-139) (HS1BP3 Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
L4440
Plasmid#1654DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseRNAiTagsT7p, T7p, lacZN, OriF1>>, OriF1<<ExpressionWormMutationPromoterAvailable sinceMarch 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
pChillyBoys_gen1
Plasmid#228495PurposepACYCDuet-1 encoding Oleispira antarctica GroEL and GorES low temp chaperonins for enhanced low-temperature induction (E. coli based protein expression)DepositorInsertsgroEL
groES
UseTagsExpressionBacterialMutationPromoterT7 PromoterAvailable sinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGBScrispri Sham
Plasmid#223201PurposeGroup B Streptococcus inducible dCas12 CRISPRi with Modular crRNADepositorInsertN/A
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET15-MHL
Plasmid#26092PurposeSGC Empty backbone for bacterial expression under T7 promoter. Uses infusion based cloning method.DepositorTypeEmpty backboneUseTags6xHis and TEV cleavage siteExpressionBacterialMutationPromoterT7-lacO (lactose/IPTG inducible)Available sinceSept. 6, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
SUMO-PNGaseF
Plasmid#228498Purpose10xHis-SUMO (Smt3) tagged PNGaseF (E. coli based protein expression)DepositorInsertngl
UseTags10xHis-SUMO(Smt3)ExpressionBacterialMutationPromoterT7 PromoterAvailable sinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMmaPylT_EF1_mCherry_TAG_EGFP
Plasmid#174893Purposeamber suppression reporter mCherry-TAG-EGFP expression, with MmaPylT amber suppressor tRNA cassetteDepositorInsertmCherry and EGFP
UseTagsExpressionMammalianMutationPromoterEF1Available sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
Clover2-N1
Plasmid#54537PurposeLocalization: N1 Cloning Vector, Excitation: 505, Emission: 515. This plasmid encodes dClover2 H231L based on Bajar et. al. Sci Rep. 2016.DepositorTypeEmpty backboneUseTagsClover2ExpressionMammalianMutationPromoterAvailable sinceJune 12, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
BII-gR-PnTW
Plasmid#133356PurposePiggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications) coexpressed with tdTomato-NLSDepositorInserttdTomato-NLS
UseTagsHA-tagged tdTomatoExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free)Available sinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
Clover2-C1
Plasmid#54711PurposeLocalization: C1 Cloning Vector, Excitation: 505, Emission: 515. This plasmid encodes dClover2 H231L based on Bajar et. al. Sci Rep. 2016.DepositorTypeEmpty backboneUseTagsClover2ExpressionMammalianMutationPromoterAvailable sinceJune 12, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSBbi-Pur-AktAR2
Plasmid#125195PurposeSB-transposon plasmid for stable expression of AktAR2 variant of FRET-based AKT activity reporterDepositorInsertAktAR2
UseTransposonTags6xHis, T7, and Xpress, mCerulean3 and cpVenus[E17…ExpressionMammalianMutationPromoterEF1a/RPBSAAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
dClover2-Cx43-7
Plasmid#56532PurposeLocalization: Gap Junctions, Excitation: 505, Emission: 515. This plasmid encodes dClover2 A206K, H231L based on publication.DepositorInsertCx43
UseTagsdClover2ExpressionMammalianMutationPromoterCMVAvailable sinceDec. 5, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits