-
Plasmid#181844PurposeGenetically encoded FRET-based sensor for monitoring PKA activity near a protein of interest. Must pair with GFP11-tagged POI to reconstitute donor fluorescence.DepositorInsertFluoSTEP-AKAR
UseTagsmRuby2 and sfGFP(1-10)ExpressionMammalianMutationPromoterCMVAvailable sinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ACTB_sgRNA
Plasmid#183884PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorInsertACTB sgRNA spacer (ACTB Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
ARB366
Plasmid#124049PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to KRAB domain P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::KRAB-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB367
Plasmid#124050PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to VPR domain P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::VPR-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIA3
Plasmid#109399PurposeExpresses sgRNA cassette (BsmBI cloning site) and EF1-A driven eSpCas9 linked via P2A with mRuby2 and dominant negative mtp53 for enhanced survival of hES after DSBDepositorTypeEmpty backboneUseCRISPRTagsmRuby2 and mtp53dnExpressionMammalianMutationPromoterEF1aAvailable sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FluoSTEP-ICUE
Plasmid#181845PurposeGenetically encoded FRET-based sensor for monitoring cAMP dynamics near a protein of interest. Must pair with GFP11-tagged POI to reconstitute donor fluorescence.DepositorInsertFluoSTEP-ICUE (RAPGEF3 Human)
UseTagsmRuby2 and sfGFP(1-10)ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLNL1135
Plasmid#160866PurposePJ23110-RBS-CAT-taa-mRuby2-tL3S2P24_KanR_p15ADepositorInsertChloramphenicol Acetyltransferase
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPJ23110_BBa_B0029Available sinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-postASAP-p2a-ChrimsonR
Plasmid#178794PurposeExpresses voltage sensor targeted to dendrites and spines along with ChrimsonRDepositorInsertFingR.PSD95, ASAP2f and ChrimsonR
UseTagsmRuby2ExpressionMammalianMutationmutations in amino acids L146G, S147T N149R, S150…PromoterCAGAvailable sinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJB1338
Plasmid#218592PurposeExpress a red fluorescent protein to the peroxisome membrane via tethering to a truncated Pex22DepositorInsertPex22
UseTagsExpressionYeastMutationPex22(1-36)PromoterAvailable sinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-Ruby2-NS
Plasmid#166569PurposeMultisite Gateway middle entry clone encoding mRuby2. Parton lab clone DJADepositorInsertRuby2
UseMultisite gateway entry cloneTagsExpressionMutationPromoterAvailable sinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBW842_pCAG-pExpr-FP-DECODER
Plasmid#87551PurposeExpresses BFP, GFP, iRFP, and mRuby in response to combinations of Cre and Flp recombinasesDepositorInsertmtagBFP, EGFP, iRFP720, mRuby2
UseCre/Lox and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Nabi2.244
Plasmid#73756PurposeNabi2.244 is a FRET (Förster Resonance Energy Transfer)-based protein voltage sensor. This probe contains Clover and mRuby2 inserted at different locations in the Ciona voltage sensitive domain.DepositorInsertNabi2.244
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nabi2.242
Plasmid#73754PurposeNabi2.242 is a FRET (Förster Resonance Energy Transfer)-based protein voltage sensor. This probe contains Clover and mRuby2 inserted at different locations in the Ciona voltage sensitive domain.DepositorInsertNabi2.242
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJJB1340
Plasmid#218593PurposeExpress a red fluorescent protein to the peroxisome membrane via tethering to a truncated Pex22. Also overexpresses Pex11DepositorInsertPex22
UseTagsExpressionYeastMutationPex22(1-36)PromoterAvailable sinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
Nabi2.30
Plasmid#73798PurposeNabi2.30 is a FRET (Förster Resonance Energy Transfer)-based protein voltage sensor. This probe contains Clover and mRuby2 inserted at different locations in the Ciona voltage sensitive domain.DepositorInsertNabi2.30
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nabi2.104
Plasmid#73799PurposeNabi2.104 is a FRET (Förster Resonance Energy Transfer)-based protein voltage sensor. This probe contains Clover and mRuby2 inserted at different locations in the Ciona voltage sensitive domain.DepositorInsertNabi2.104
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nabi2.125
Plasmid#73800PurposeNabi2.125 is a FRET (Förster Resonance Energy Transfer)-based protein voltage sensor. This probe contains Clover and mRuby2 inserted at different locations in the Ciona voltage sensitive domain.DepositorInsertNabi2.125
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nabi2.216
Plasmid#73801PurposeNabi2.216 is a FRET (Förster Resonance Energy Transfer)-based protein voltage sensor. This probe contains Clover and mRuby2 inserted at different locations in the Ciona voltage sensitive domain.DepositorInsertNabi2.216
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nabi2.226
Plasmid#73802PurposeNabi2.226 is a FRET (Förster Resonance Energy Transfer)-based protein voltage sensor. This probe contains Clover and mRuby2 inserted at different locations in the Ciona voltage sensitive domain.DepositorInsertNabi2.226
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only