We narrowed to 5,265 results for: crispr cas9 expression plasmids
-
Plasmid#222859PurposeThis plasmid codes for the Slug-KH nickase with a sg(AGC)6DepositorInsertSlug-KHD10A+sgAGC
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgCAG-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222858PurposeThis plasmid codes for the Slug-KH nickase with a sg(CAG)6DepositorInsertSlug-KHD10A+sgCAG
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-sgGCA-SlugD10A-3XFLAG-SV40 NLS-ITR2
Plasmid#222860PurposeThis plasmid codes for the Slug-KH nickase with a sg(GCA)6DepositorInsertSlug-KHD10A+sgGCA
UseCRISPRTags3X FLAG, SV40 NLS, ITR2 and ITR2ExpressionMammalianMutationKH variant and D10A mutationPromoterH1 and eCMVAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA
Plasmid#177360PurposeAAV expression of Chimeric guide for SaCas9 and reverse tetracycline-controlled transactivator for doxycycline controlled expression from Synapsin promoterDepositorInsertstdTomato
Chimeric guide for SaCas9
UseAAVTagsP2A and a tetracycline-controlled transactivator …ExpressionMammalianPromoterSynapsine promoter and U6 promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
px459 sgFIP200
Plasmid#175024PurposeCRISPR-Cas9 plasmid targeting exon 3 of human FIP200.DepositorInsertRB1CC1 (RB1CC1 Human)
ExpressionMammalianAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-dead R-IscB (D60A, H269A)-NLS_T2A_mCherry_U6-ωRNA
Plasmid#246430PurposeAll-in-one plasmid. Expresses R-IscB in mammalian cells. Dead mutations included.DepositorInsertsO.gue IscB with dead mutations (D60A, H269A) and delta-TID
mCherry
ωRNA
TagsSV40 NLS, Thosea asigna virus 2A peptide, and nuc…ExpressionMammalianMutationchanged Aspartic Acid 60 to Alanine, changed Hist…PromoterCMV and U6Available SinceOct. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
Orco-T2A-QF2-9xQUAS-GCaMP6f-3XP3-dsRed
Plasmid#157974PurposeTemplate plasmid for inserting GCaMP reporter into the Orco gene of Aedes aegypti with CRISPR/Cas9DepositorInsertOrco
ExpressionInsectAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-iRFP-STOP-ReNL
Plasmid#113965PurposePiggybac transposon plasmid CRISPR gene deletion activatable fluorescence. Constitutive iRFP670 under EF1A promoter, CMV promoter with two SV40 polyA followed by red-enhanced nanolantern (ReNL)DepositorInsertsiRFP670
ReNL
UsePiggybac transposonExpressionMammalianPromoterCMV - SV40-PolyA - SV40-PolyA and EF1AAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAS_gpyrG2
Plasmid#90277Purpose(also pMST620-BB3_gpyrG2_cas9) CRISPR/Cas9 plasmid with gRNA for site pyrG2, Cas9DepositorInsertgRNA (pyrg2)
UseA. nigerExpressionBacterialAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lv EF1a HP1cs-Frb2x PGK Puro
Plasmid#102809PurposeLentiviral plasmid from FIRE-Cas9 system to express HP1cs-Frb2x fusion proteinDepositorInsertHP1cs-Frb2x
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-TREX2-N
Plasmid#244025PurposeGateway entry plasmid (attL1& attR5) expressing TREX2 exonuclease fused to the N-terminus of LbCas12a, connected by a flexible XTEN linker, without promoterDepositorInsertCas12a
UseCRISPRTagsTREX2Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-AtEXO1B-N
Plasmid#244024PurposeGateway entry plasmid (attL1& attR5) expressing AtEXO1B exonuclease fused to the N-terminus of LbCas12a, connected by a flexible XTEN linker, without promoterDepositorInsertCas12a
UseCRISPRTagsAtEXO1BAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
Syt1LeftArm-3XGS-GCaMP6s-SV40-3XP3-dsRed-SV40-Syt1RightArm
Plasmid#159636PurposeDonor plasmid for generating Syt1:GCaMP6s strain in Aedes aegypti with CRISPR/Cas9DepositorInsertGCaMP6s
ExpressionInsectAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEL667
Plasmid#196815PurposeLrCas9 genome editing plasmid in wheatDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL668
Plasmid#196816PurposeLrCas9 genome editing plasmid in larixDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterLrk004PAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL669
Plasmid#196817PurposeLrCas9 genome editing plasmid in tomatoDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterSlEF1aAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001146109)
Plasmid#80242Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001146001)
Plasmid#80243Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only