We narrowed to 43,944 results for: gats
-
Plasmid#224484PurposeGateway compatible middle entry clone containing V5 tagged mTagBFP2 (Cytosolic blue fluorescent reporter)DepositorInsertV5-mTagBFP2
UseGateway cloningAvailable SinceSept. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-V5-mScarlet-I_SV40pA (JDW 968)
Plasmid#224529PurposeA Gateway compatible 3' entry clone containing an V5 mScarlet fusion followed by SV40 late polyADepositorInsertV5-mScarlet-I
UseGateway cloningAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-CDC42-DN
Plasmid#109584PurposeMultisite gateway vector for 3' tagging with dominant negative CDC42DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
[pSK483] pLJC5 Flag-Depdc5(P)
Plasmid#109342PurposeLenti-viral expression of Flag-tagged Depdc5 mutant PDepositorAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS405 PEX14-VAC8-RFP
Plasmid#166844PurposeExpresses Peroxisome localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 390 base pairs from the PEX14 ORFDepositorTagsPEX14 transmembrane domain and RFPExpressionYeastMutationPEX14 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS405 SEC66-VAC8-RFP
Plasmid#166843PurposeExpresses ER localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 162 base pairs from the SEC66 ORF, which encode the Sec66 transmembrane domain.DepositorTagsRFP and SEC66 transmembrane domainExpressionYeastMutationSEC66 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
[pSK496] pLJC5 HA-Depdc5(AB)
Plasmid#109346PurposeLenti-viral expression of HA-tagged Depdc5 mutant ABDepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsHAMutationDIYGD(185-189)GSGSG;EQPLH(371-375)GSGSGAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
[pSK497] pLJC5 Flag-Depdc5(AB)
Plasmid#109341PurposeLenti-viral expression of Flag-tagged Depdc5 mutant ABDepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsFLAGMutationDIYGD(185-189)GSGSG;EQPLH(371-375)GSGSGAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC2
Plasmid#91180PurposeT-DNA vector for combinatorial deletion of NCR genes in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting NCR genes
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
Kv7.4 (1-645, Δ368-523)/pcDNA3.1
Plasmid#111456PurposeElectrophysiology in HEK cellDepositorInsertpotassium voltage-gated channel subfamily KQT member 4 isoform a [Homo sapiens] (KCNQ4 Human)
ExpressionMammalianMutationKv7.4 (1-645, Δ368-523), C643AAvailable SinceMay 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSC3
Plasmid#91181PurposeT-DNA vector for targeted deletion of 58kb region in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
p3E-mCherry-SV40-pA (JDW 1417)
Plasmid#242570PurposeGateway 3' entry clone containing mCherry followed by an SV40 polyA.DepositorInsertmCherry stop SV40 pA
UseGateway subcloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXMLC2-DEST (JDW 7)
Plasmid#229833PurposeA gateway compatible destination vector containing the Xenopous myosin light chain 2 promoter for embryonic and adult cardiomyocyte expression.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-StayGoldc4-Giantin (JDW 1355)
Plasmid#229844PurposeA gateway compatible middle entry clone containing a V5 tagged n2StayGoldc4 flourescent proteinDepositorInsertn2StayGoldc4
UseGateway entry cloneAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
p5E_hs_Glast (JDW 1182)
Plasmid#224483PurposeGateway compatible 5' entry clone containing the Human GLAST promoterDepositorInsertGLAST promoter
ExpressionMammalianAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-LexA-mODC (no LexOp) (JDW 937)
Plasmid#224504PurposeGateway compatible middle entry clone containing a destabilized LexA transactivatorDepositorInsertLexA-mODC
UseGateway cloningAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME H2B mCerulean (JDW 1150)
Plasmid#224543PurposeA Gateway compatible middle entry clone containing a histone H2B fusion to mCerulean to label the nucleusDepositorInsertH2B-mCerulean
UseGateway cloningAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-His10-ccdB-SNAP
Plasmid#166146PurposeGateway destination vector for generation of N-terminal His10-tagged and C-terminal SNAP-tagged proteins in E. coli.DepositorTypeEmpty backboneTagsHis10 and SNAPExpressionBacterialAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only