We narrowed to 8,673 results for: reporter
-
Plasmid#109429PurposeExpresses the C-terminal catalytically inactive mutant of human APOBEC3B containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal Doman E255A Catalytic Mutant (APOBEC3B Human)
UseCRISPRExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2+Brd9 (zebrafish) partial UTR and coding sequence-EGFP
Plasmid#248787Purposefuse partial UTR and coding sequence of Brd9 (zebrafish) with EGFP reporterDepositorInsertbrd9 (brd9 Zebrafish)
UseBrd9(zebrafish)-egfp reporterTagsEGFPPromoterpartial 5'UTR sequence of zebrafish brd9Available SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
STIM1-RspA-NFAST
Plasmid#233606PurposeExpression of hSTIM1-RspA-NFASTDepositorAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc LifeactΔC4-msfGFPΔN7
Plasmid#231555PurposeMammalian expression of C-terminally truncated Lifeact fused to N-terminally truncated monomeric superfolder GFP for actin filament organization measurements using fluorescence polarization microscopyDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-MARINA
Plasmid#223328PurposeDONOR vector for genomic integration of MARINA voltage sensitive indicator gene from Platisa et al., 2017 (10.1021/acschemneuro.6b00234).DepositorInsertsMARINA
KIR2.1 channel Golgi-to-plasma membrane trafficking signal
UseCRISPR and Synthetic BiologyTagsmCherry and super-ecliptic pHluorinExpressionMammalianPromoterCAGAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT360 AAV-Rapamycin Inducible-noActivator Domain -Citrine
Plasmid#202058PurposeInducible AAV with reporter gene and cloning site to add activator domainsDepositorInsertAAV-Rapamycin Inducible-noActivator Domain -Citrine
UseAAV; Aav with reporterExpressionMammalianMutationITRs intactAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
PCRbluntII-pHES7-STOPgRNA
Plasmid#204349PurposegRNA to target pig HES7 stop codonDepositorInsertPig HES7-STOP-gRNA (HES7 Sus domesticus (pig))
ExpressionMammalianAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pInt_attP1_LCS_kanR
Plasmid#205300PurposeIntegrating plasmid for ORBIT in E. coli. Contains library cloning site (LCS), which has transcriptional terminators to insulate reporter constructs.DepositorArticleTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNL [NlucP/STAT5-RE/Hygro] Vector
Plasmid#236819PurposeExpress STAT5 response element in luciferase reporter assayDepositorHas ServiceDNAInsertSTAT5 (STAT5A Human)
UseLuciferaseTagsNanoLuc (R)MutationNonePromoterminPAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAVS1-SAGFP
Plasmid#127100PurposeSA-GFP substrate (Addgene #41594) flanked by human AAVS1 homology arms. Endogenous AAVS1 promoter drives T2A-hygromycin expression after integration. SA-GFP cassette contains PGK-puromycin.DepositorInsertSA-GFP reporter
ExpressionMammalianAvailable SinceJune 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10-Rnd3 promoter [-1759 +248]
Plasmid#86438PurposeFirefly luciferase reporter under control of the Rnd3 promoterDepositorInsertRnd3 promoter (RND3 Human)
UseLuciferaseTagsLuciferase (under Rnd3 promoter control)ExpressionMammalianMutationpromoter sequence derived from HepG2 cellsAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4 [luc2P/STAT4-RE/Hygro] Vector
Plasmid#236820PurposeExpress STAT4 response element in luciferase reporter assayDepositorAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCDH-PGK-Nluc-P2A-copGFP-T2A-Puro
Plasmid#73040PurposeExpress Nluc and copGFP dual reporter in mammalian cellsDepositorInsertNluc-P2A-copGFP-T2A-Puro
UseLentiviral and LuciferaseExpressionMammalianPromoterPGK (phosphoglycerate kinase 1)Available SinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPROBE-AT'
Plasmid#37813DepositorInsertPromotorless gfp reporter gene
Available SinceJuly 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 LC3Flux (HaloTag7-mGFP-LC3-STOP)
Plasmid#215004PurposeShuttling vector for an autophagy (LC3) reporterDepositorAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-BbsI-CMV-EGFP cloning vector
Plasmid#239464PurposesgRNA cloning vector with EGFP expression cassette. An sgRNA spacer sequence can be cloned into BbsI sites. A CMV-EGFP expression cassette is included as a reporter of transfection efficiency.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 and CMVAvailable SinceDec. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
GBH-R-gcryBFP.1
Plasmid#187995PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted mRFP protein trap; secondary marker gamma crystallin BFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; gamma crystallin promotorAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNL [NlucP/HSE/Hygro] Vector
Plasmid#236926PurposeExpress HSE in luciferase reporter assayDepositorHas ServiceDNAInsertHSE (HSD17B6 Human)
UseLuciferaseTagsNanoLuc (R)MutationNonePromoterminPAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits