We narrowed to 490 results for: CAG synthetic promoter
-
Plasmid#184611PurposeFor expression of a fluorescent sensor for nociceptin in mammalian cellsDepositorInsertMTRIA-NOC
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-PAF
Plasmid#184616PurposeFor expression of a fluorescent sensor for platelet-activating factor in mammalian cellsDepositorInsertMTRIA-PAF
ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-UTS
Plasmid#184620PurposeFor expression of a fluorescent sensor for urotensin II in mammalian cellsDepositorInsertMTRIA-UTS
ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-NTS
Plasmid#184614PurposeFor expression of a fluorescent sensor for neurotensin in mammalian cellsDepositorInsertMTRIA-NTS
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-NMB
Plasmid#184610PurposeFor expression of a fluorescent sensor for neuromedin B in mammalian cellsDepositorInsertMTRIA-NMB
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7 probasin_mTQ2_FlpO
Plasmid#68356Purpose-The prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_version2_U6_AtPDS3_gRNA10
Plasmid#197952PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter, with SV40 NLS at the C-terminal , and the AtPDS3 guide RNA 10 driven by U6 promoter.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterAtU6-26 and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV(gRNA)-CMV-eGFP-U6(sgCTG)
Plasmid#216732PurposeContains a eGFP gene along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Used with the HD iPSC-derived astrocytesDepositorArticleInsertsgCTG lentiviral guide RNA with eGFP tag
UseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_2x35Sp_HSP18t_ribozyme_AtPDS3_gRNA10
Plasmid#197959PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by 2x35Sp and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoter2x35S promoter and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_pUB10_E9t_ribozyme_AtPDS3_gRNA10
Plasmid#197960PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by UBQ10 gene promoter and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterpUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCLYBL-Neo_TRE3VG_mCherry_Responder
Plasmid#230054PurposeIt presents the TRE3VG inducible promoter allowing the dox-dependent inducible activation of mCherry through the OPTi-OX platform. The CLYBL GSH supports higher transgene expressionDepositorInsertTRE3VG_mCherry
ExpressionMammalianPromoterTRE3VGAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJM597 ZF(2/6)x3 mKate2 in TUPV1
Plasmid#161531PurposeInducible expression of mKate2 under the ZF(2/6)x3 promoterDepositorInsertmKate2
UseSynthetic BiologyExpressionMammalianPromoterZF(2/6)x3Available SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmEmerald_mEmerald_I3
Plasmid#231681PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with two tandem mEmeralds in mammalian cells. Assembles into nanocages tagged with 120 mEmerald FPs.DepositorInsertI3-01
TagsmEmeraldExpressionMammalianMutationK129APromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmEmerald_I3
Plasmid#231680PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with one mEmerald in mammalian cells. Assembles into nanocages tagged with 60 mEmerald FPs.DepositorInsertI3-01
TagsmEmeraldExpressionMammalianMutationK129APromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
Plasmid#68357PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.DepositorInserts5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterU6 and synthetic Probasin ARRx2Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBigTB-ERT2CreERT2
Plasmid#149433Purposetamoxifen-inducible Cre recombinaseDepositorInsertERT2-Cre-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBigTB-CreERT2
Plasmid#149434Purposetamoxifen-inducible Cre recombinaseDepositorInsertCre-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBigTB-FlpERT2
Plasmid#149435Purposetamoxifen-inducible Flp recombinaseDepositorInsertFlp-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only