We narrowed to 973 results for: plasmids spcas9
-
Plasmid#92353PurposeExpression plasmid for human codon-optimized wild-type SpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFlag-NLS-wild-type SpCas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianPromoterCbhAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-HiFi-P2A-EGFP (LM446)
Plasmid#197506PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-HiFi(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-HiFi-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-HiFi(D10A/R69…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
NFATc1-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75238PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc1 (1/2)DepositorInsertsgRNA against NFATc1 (NFATC1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
NFATc1-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75239PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc1 (2/2)DepositorInsertsgRNA against NFATc1 (NFATC1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-ABE-3'UTR-sgRNA-2xMS2
Plasmid#132554PurposeVector plasmid expressing ABEmax and sgRNA scaffold with MS2 replacing the Tetraloop and loop 2DepositorInsertsABEmax
sgRNA, with Tetraloop and loop 2 replaced by MS2 aptamer
ExpressionMammalianAvailable SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-eSpCas9 (without sgRNA)
Plasmid#92354PurposeExpression plasmid for human codon-optimized high-fidelity eSpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFLAG-NLS-Streptococcus pyogenes enhanced Cas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationK848A, K1003A, R1060APromoterCbhAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SpCas9-VQR-P2A-EGFP (LRF199)
Plasmid#242664PurposeCMV promoter expression plasmid for human codon optimized SpCas9-VQR-BPNLS(SV40)-3xFLAG-P2A-EGFPDepositorInsertpCMV-SpCas9-VQR-BPNLS(SV40)-3xFLAG-P2A-EGFP
UseCRISPRTagsBPNLSExpressionMammalianMutationVQR mutations in SpCas9(D1135V/R1335Q/T1337R)PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pK237.U6-Chimeric-CAG-loxP-stop-loxP-hspCas9 (Supernova)
Plasmid#85041PurposeThis plasmid should be used for Cre/loxP-based Supernova-CRISPR/Cas9.DepositorInsertloxP-stop-loxP
UseCRISPRExpressionMammalianAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-NG-P2A-EGFP (RTW3677)
Plasmid#139994PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-NG(L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-NG with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpCas9-NG=L1111R/D1135V/G1218R/E1219F/A1322R/R133…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9-T7-EGFP_gRNA1-T7term (BPK848)
Plasmid#181745Purposedual T7 promoter vector for bacterial expression of SpCas9 with a c-terminal NLS and 3xFLAG tag, along with an SpCas9 sgRNA targeting EGFP site 1DepositorInserthuman/zebrafish codon optimized SpCas9
UseIn vitro transcription; t7 promoterTagsNLS(SV40)-3xFLAGExpressionBacterialPromoterT7Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA1 (PX459)
Plasmid#221551PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCAS9 wt (BB)-2A-GFP targeting human TRIM21
Plasmid#138295PurposegRNA for CRISPR/Cas9 knockout of human TRIM21DepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA2 (PX459)
Plasmid#221552PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-NRRH-P2A-EGFP (RMD51)
Plasmid#197502PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-NRRH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-NRRH-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-NRRH(D10A/I32…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-NRTH-P2A-EGFP (RMD21)
Plasmid#197503PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-NRTH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-NRTH-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-NRTH(D10A/I32…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only