We narrowed to 1,903 results for: sfGFP
-
Plasmid#246802PurposeA GreenGate entry vector containing scFV-sfGFP fusion gene drived by an ZmUBI PromoterDepositorInsertZmUBI Promoter-scFV-sfGFP
UseGreengate cloning entry vectorAvailable sinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGGD-AtUBQ10 Promoter-scFV-sfGFP
Plasmid#246803PurposeA GreenGate entry vector containing scFV-sfGFP fusion gene drived by an AtUBQ10 PromoterDepositorInsertAtUBQ10 Promoter-scFV-sfGFP
UseGreengate cloning entry vectorAvailable sinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGGD-AtSUC2 Promoter-scFV-sfGFP
Plasmid#246801PurposeA GreenGate entry vector containing scFV-sfGFP fusion gene drived by an AtSUC2 PromoterDepositorInsertAtSUC2 Promoter-scFV-sfGFP
UseGreengate cloning entry vectorAvailable sinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-loxP-H2B-sfGFP+pCI syntron-T2A-tdTomato+RbG and HsbG syntrons
Plasmid#172480PurposeH2B-sfGFP with a synthetic intron from the pCI expression vector, T2A, and tdTomato with synthetic introns derived from the rabbit beta-globin gene and the human beta-globin geneDepositorInsertH2B-sfGFP-T2A-tdTomato
UseCre/LoxExpressionMammalianAvailable sinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFP34
Plasmid#247209PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available sinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSB1K3_pBen-sfGFP_J23101-mRFP
Plasmid#128126PurposeExpressing sfGFP under control of benzoate responsive promoter (pBen) and expressing mRFP under constitutive promoter J23101, and RBS B0032DepositorInsertsfGFP
UseSynthetic BiologyExpressionBacterialPromoterpBen (benzoate responsive promoter)Available sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4TO-sfGFP-24xGCN4_v1
Plasmid#61056PurposeA direct fusion of sfGFP to the 24xGCN4_v1 peptide arrayDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsfGFP-24xGCN4_v1 peptide array
ExpressionMammalianAvailable sinceNov. 17, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBEL1092
Plasmid#195635PurposeExpression/purification of 6xHis-TEV-sfGFPDepositorInsertsfGFP
ExpressionBacterialAvailable sinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-sfGFP
Plasmid#184226PurposeExpresses SpyTag-superfolder GFP in the bacterial cytoplasm. SpyTag enables covalent reaction with SpyCatcher.DepositorInsertSpyTag-sfGFP
TagsHis6, SpyTag, and TEV protease cleavage siteExpressionBacterialPromoterT5Available sinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBAD/HisB (TIRSTD)-sfGFP
Plasmid#189674Purposetitratable expression of sfGFP in bacteriaDepositorInsertsfGFP
TagsHis-T7-EKExpressionBacterialPromoterpBADAvailable sinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pXJ520-pAAV-PB3'IR-CAG-MCP-GFP-KASH-6XMS2-hU6-gRNA-PB5'IR
Plasmid#254955PurposeAAV piggyBac vector with single gRNA and CAG-driven MCP-sfGFP-KASH reporter; optimized for snRNA-seq and sn-multiome Perturb-seq via nuclear-enriched gRNA capture.DepositorInsertMCP-sfGFP-KASH
UseAAV and CRISPRExpressionMammalianAvailable sinceJune 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pME_G_E_007_UAV_sfGFP_PaqCI
Plasmid#235975PurposeUniversal acceptor vector with sfGFP placeholder PaqCI compatible for lvl0 assemblyDepositorInsertUAV_sfGFP_PaqCI
UseSynthetic BiologyAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-sfGFP-GSAx9-iCre-ERT2
Plasmid#125748PurposesfGFP and iCreERT2 fused by GSAx9 linkerDepositorInsertsfGFP-GSAx9-iCre-ERT2
UseCre/LoxExpressionMammalianAvailable sinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A sfGFP 150TAG
Plasmid#154772Purposeplasmid with 4xhybrid PylT cassette (Mx1201 G1 PylT hybrid mutant A41AA C55A) and amber suppression reporter sfGFP 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsfGFP
ExpressionMammalianMutation150TAG in GFP reporter, hybrid PylT with A41AA an…PromoterEF1Available sinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-pT3-tetR-sfGFP
Plasmid#140871PurposeT3 promoter driven synthesis of TetR-sfGFPDepositorInsertTetR-sfGFP expressed with T3 promoter
UseSynthetic BiologyTagssfGFPExpressionBacterialPromoterT3Available sinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRMC2-msfGFP
Plasmid#194913PurposeTetracycline inducible expression of msfGFP in StaphylococciDepositorInsertShine Dalgarno Sequence followed by monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…ExpressionBacterialAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xG1 PylT sfGFP 150TAG
Plasmid#154767Purposeplasmid with 4xG1 PylT cassette and amber suppression reporter sfGFP 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation150TAGPromoterEF1Available sinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available sinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAPInt-sfGFP-G418
Plasmid#236481PurposePlasmid for deleting or C-terminally tagging endogenous genes with sfGFP and selection on G418.DepositorInsertsfGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable sinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only