168,566 results
-
Plasmid#189923PurposeAAV genome encoding SaKKHABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e V106W
UseAAVMutationnSaCas9 KKH, TadA ABE8e V106WPromoterEFSAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pinducer 20 DN-KASH
Plasmid#125554PurposeTet-ON inducible lentivirus expressing mcherry-labeled DN KASHDepositorInsertSYNE1 (SYNE1 Human)
UseLentiviralTagsmcherryMutationTruncated form: only the KASH domain of nesprin-…Promotertetracycline responsive elementAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX333-T2A-EGFP
Plasmid#197417PurposeSpCas9-T2A-EGFP with dual sgRNA cloning backbonesDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCBh; U6Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_NSlmb-vhhGFP4
Plasmid#35579DepositorInsertNSlmb-vhhGFP4 (slmb Fly)
ExpressionMammalianAvailable SinceApril 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
p11-LacY-wtx1
Plasmid#69056PurposeThe reporter plasmid p11-LacY-wtx1 encodes the toxin CcdB gene under the inducible BAD promoter and a single copy of the endonuclease cleavage site which is readily extendable to multiple copies.DepositorAvailable SinceSept. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(mScarlet-FLAG) matched positive control in pTwist-CMV
Plasmid#216156PurposeExpresses mScarlet regardless of TDP-43 knockdown. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertmScarlet with C-terminal FLAG tag
ExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNF02-mLemon
Plasmid#219399PurposeConstitutive expression of mLemon in E. coliDepositorInsertmLemon
ExpressionBacterialPromoterproDpAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 mycBioID
Plasmid#35700PurposeTo fuse your protein of interest to the C-terminus of BirA(R118G) and use in proximity-dependent biotin identification (BioID); myc tagDepositorHas ServiceCloning Grade DNAInsertBirA
TagsMycExpressionMammalianMutationR118G (highly promiscuous form)PromotercmvAvailable SinceApril 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRN112
Plasmid#84464PurposepJB38-NWMN29-30+ SarA_P1-mAmetrine-TermDepositorInsertSarA_P1-mAmetrine from pRN12
UseSynthetic BiologyAvailable SinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits only