We narrowed to 4,490 results for: GCA
-
Plasmid#106709Purposeexpression of gRNA targeting ST6GALNAC5DepositorInsertST6GALNAC5 (ST6GALNAC5 Human)
ExpressionMammalianAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pLENTICRISPR sgNFS1
Plasmid#102979PurposeCutting NFS1 genomic locusDepositorInsertsgNFS1 (NFS1 Human)
UseCRISPR and LentiviralAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shNFS1_4
Plasmid#102966PurposeSuppression of NFS1DepositorInsertshNFS1_4 (NFS1 Human)
UseLentiviral and RNAiAvailable SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459-TMEM217-gRNA#1
Plasmid#249417PurposepX459-gRNA#1 targeting the 5′ coding region of human TMEM217DepositorInsertTMEM217 (TMEM217 Human)
UseCRISPRAvailable SinceFeb. 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
DJ-L1 gRNA #5
Plasmid#247545PurposeCRISPRi-KD of human DJ LINE1DepositorInsertsgRNA targeting human L1DJ
UseCRISPRExpressionMammalianMutationnoneAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
DJ-L1 gRNA #4
Plasmid#247544PurposeCRISPRi-KD of human DJ LINE1DepositorInsertsgRNA targeting human L1DJ
UseCRISPRExpressionMammalianMutationnoneAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
DJ-L1 gRNA #3
Plasmid#247543PurposeCRISPRi-KD of human DJ LINE1DepositorInsertsgRNA targeting human L1DJ
UseCRISPRExpressionMammalianMutationnoneAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Fzd1/2 gRNA
Plasmid#246562PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd1/2 gRNA (conserved region)DepositorInsertFzd1/2 gRNA
UseCRISPRPromoterU6Available SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX458 BLTP3A knockout
Plasmid#241256PurposeKnock-out plasmid targeting the second exon of human BLTP3A (UHRF1BP1)DepositorInsertBLTP3A (UHRF1BP1) KO gRNA (BLTP3A Human)
ExpressionMammalianAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ40-PB-CRISPR-NKX3.1-E2-gRNA3
Plasmid#131083PurposeNKX3-1 knock outDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW306_U6-sgRNA-EMX1
Plasmid#244824PurposeMammalian expression of SpyCas9 single guide RNA targeting EMX1DepositorInsertSpyCas9 single guide RNA
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP24 (pAVA3555)
Plasmid#239242PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP24DepositorInsertU6-driven sgRNA targeting RMP24
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP24 (pAVA3563)
Plasmid#239258PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP24DepositorInsertU6-driven sgRNA targeting RMP24
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP64 (pAVA3572)
Plasmid#239259PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP64DepositorInsertU6-driven sgRNA targeting RMP64
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbSTM-5'UTR
Plasmid#231150PurposeT-DNA encoding TRV2 with mobile gRNA targeting NbSTM-5?UTRDepositorInsertmobile gRNA targeting NbSTM-5?UTR
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 shCavin1KDR-EGFP
Plasmid#187254PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of mouse Cavin1 (Cavin1 rescue)DepositorAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
RhoB gRNA #1
Plasmid#198721PurposeCas9-mediated knockout of RhoB in mammalian cells #1DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
RhoB gRNA #3
Plasmid#198723PurposeCas9-mediated knockout of RhoB in mammalian cells #3DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only