We narrowed to 3,426 results for: ttl
-
Plasmid#138124PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized BsCas12a with N512R, K518V and N522R mutations, without promoterDepositorInsertBsCas12a RVR variant
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationN512R, K518V and N522RAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ285-RVR
Plasmid#138121PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized Lb5Cas12a with N512R, K518V and N522R mutations, without promoterDepositorInsertLb5Cas12a RVR variant
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationN512R, K518V and N522RAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-fbp_RiboJ_GFP+_MGApt_Bba_B0015
Plasmid#107578PurposeB. megaterium DSM319 fbp promoter, GFP+ with malachite green mRNA aptamer for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertGFP+
UseSynthetic BiologyTagsB. megaterium DSM319 xylA leader sequence (MTSSKI…ExpressionBacterialMutationF64L/ S65T/ Q80R/ F99S/ M153T/ V163APromoterfbp promoter Bacillus megaterium DSM319Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC6A4_STOP
Plasmid#161338PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC6A4 (SLC6A4 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
TH0901-pOCC177-FUS-wt_opt(Nhe)
Plasmid#221885PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
Tags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationwtPromoterPH promoterAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_9
Plasmid#60258PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertNKX6-1 enhancer (NKX6-1 Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_10
Plasmid#60259PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertRFX6 enhancer (RFX6 Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_25
Plasmid#60268PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertROCK1 enhancer (ROCK1 Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
TH1150-pOCC177-FUS(Nhe)-PLD_YtoF_RGG_RtoK
Plasmid#221889PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
Tags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationIn PLD all Tyr (Y) changed to Phe (F), in RGG (aa…PromoterPH promoterAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
TH0994-pOCC177-Fus-wt_(1-211)
Plasmid#221886PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
Tags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationPLD domain (aa 1-211)PromoterPH promoterAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH1148-pOCC177-FUS(Nhe)-PLD_YtoF
Plasmid#221887PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
Tags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationIn PLD all Tyr (Y) changed to Phe (F)PromoterPH promoterAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH1149-pOCC177-FUS(Nhe)-RGG_RtoK
Plasmid#221888PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
Tags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationIn RGG (aa 212-526) most of Arg (R) changed to Ly…PromoterPH promoterAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH1202-pOCC175_pOEM1-N-HIS-MBP-PS-mGFP-TEV-HNRNPA3_opt
Plasmid#221890PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertHNRNPA3 (HNRNPA3 Human)
Tags6xHis-MBP-PreScission-mGFP-TEVExpressionInsectMutationwtPromoterPH promoterAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOEM1_pCMV:deltaN-bmp4-pPH:vsvged
Plasmid#111158PurposeBaculovirus rescue vector, VSVGED pseudotype, hShhDepositorInsertdeltaNhBmp4 (BMP4 Human)
UseBaculoviral rescue shuttle vectorExpressionInsect and MammalianMutationdelta N, mutant BMP lacking the N terminus (delta…PromoterCMVAvailable SinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_7
Plasmid#60256PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertSLC30A8 enhancer (SLC30A8 Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_15
Plasmid#60262PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertFAM148A enhancer (C2CD4A Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_17
Plasmid#60263PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertZFAND3 enhancer (ZFAND3 Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_18
Plasmid#60264PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertZBED3 enhancer (ZBED3 Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_19
Plasmid#60265PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertTHADA enhancer (THADA Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only