We narrowed to 3,496 results for: ttl
-
Plasmid#161338PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC6A4 (SLC6A4 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXN1
Plasmid#101445PurposeDonor Vector containing FOXN1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXN1 (FOXN1 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
TH0901-pOCC177-FUS-wt_opt(Nhe)
Plasmid#221885PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
Tags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationwtPromoterPH promoterAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXQ1
Plasmid#101628PurposeDonor Vector containing FOXQ1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXQ1 (FOXQ1 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_9
Plasmid#60258PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertNKX6-1 enhancer (NKX6-1 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HES3
Plasmid#101411PurposeDonor Vector containing HES3 transcription factor, part of the Human TFome CollectionDepositorInsertHES3 (HES3 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_10
Plasmid#60259PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertRFX6 enhancer (RFX6 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_25
Plasmid#60268PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertROCK1 enhancer (ROCK1 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
TH1150-pOCC177-FUS(Nhe)-PLD_YtoF_RGG_RtoK
Plasmid#221889PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
Tags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationIn PLD all Tyr (Y) changed to Phe (F), in RGG (aa…PromoterPH promoterAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
TH0994-pOCC177-Fus-wt_(1-211)
Plasmid#221886PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
Tags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationPLD domain (aa 1-211)PromoterPH promoterAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH1148-pOCC177-FUS(Nhe)-PLD_YtoF
Plasmid#221887PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
Tags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationIn PLD all Tyr (Y) changed to Phe (F)PromoterPH promoterAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH1149-pOCC177-FUS(Nhe)-RGG_RtoK
Plasmid#221888PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertFUS (FUS Human)
Tags6xHis-MBP-PreScission and TEV-SNAP-tagExpressionInsectMutationIn RGG (aa 212-526) most of Arg (R) changed to Ly…PromoterPH promoterAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH1202-pOCC175_pOEM1-N-HIS-MBP-PS-mGFP-TEV-HNRNPA3_opt
Plasmid#221890PurposeShuttle vector for baculovirus production, using FlashBac bacmidDepositorInsertHNRNPA3 (HNRNPA3 Human)
Tags6xHis-MBP-PreScission-mGFP-TEVExpressionInsectMutationwtPromoterPH promoterAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXI3
Plasmid#101518PurposeDonor Vector containing FOXI3 transcription factor, part of the Human TFome CollectionDepositorInsertFOXI3 (FOXI3 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ASCL3
Plasmid#101515PurposeDonor Vector containing ASCL3 transcription factor, part of the Human TFome CollectionDepositorInsertASCL3 (ASCL3 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HOXB3
Plasmid#101478PurposeDonor Vector containing HOXB3 transcription factor, part of the Human TFome CollectionDepositorInsertHOXB3 (HOXB3 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXE1
Plasmid#101439PurposeDonor Vector containing FOXE1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXE1 (FOXE1 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXE3
Plasmid#101429PurposeDonor Vector containing FOXE3 transcription factor, part of the Human TFome CollectionDepositorInsertFOXE3 (FOXE3 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXH1
Plasmid#101431PurposeDonor Vector containing FOXH1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXH1 (FOXH1 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only