We narrowed to 3,846 results for: 28
-
Plasmid#109341PurposeLenti-viral expression of Flag-tagged Depdc5 mutant ABDepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsFLAGMutationDIYGD(185-189)GSGSG;EQPLH(371-375)GSGSGAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-cGAS R71/75E C396/7A-HA
Plasmid#130920PurposeExpresses human cGAS with R71/75E and C396/397A point mutations; Puromycin selection markerDepositorInserthuman cGAS R71/75E C396/7A
TagsHAExpressionMammalianMutationaa 71 and 75 mutated to glutamate; aa 396 and 397…PromoterCMVAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Flag-full length mSesn2 (FL: A+B+C)
Plasmid#111796PurposeMammalian Expression of mSesn2DepositorAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZS1[FruR-T,LacI-T]
Plasmid#60768PurposeContains PIq driving expression FruR-T, and PI driving expression of LacI-T.DepositorInsertsFruR-T
Dimeric LacI with the TAN DBD
UseSynthetic BiologyExpressionBacterialMutationDimeric LacI with the TAN DBD. and LacI/GalR repr…Available SinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[GalS-T,RbsR-T]
Plasmid#60773PurposeContains PIq driving expression GalS-T, and PIq driving expression of RbsR-T.DepositorInsertsGalS-T
GalS-T
UseSynthetic BiologyExpressionBacterialMutationLacI/GalR repressor chimera. TAN DBD with GalS LB…Available SinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA8-Flag-LARS(1-360aa)
Plasmid#139668PurposeExpresses N-teminal Flag tagged aa 1-360 of LARS1 proteinDepositorAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS1[GalS-T,TreR-T]
Plasmid#60775PurposeContains PIq driving expression GalS-T, and PI driving expression of TreR-T.DepositorInsertsGalS-T
TreR-T
UseSynthetic BiologyExpressionBacterialMutationLacI/GalR repressor chimera. TAN DBD with GalS LB…Available SinceMay 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[FruR-T,TreR-T]
Plasmid#60772PurposeContains PIq driving expression FruR-T, and PIq driving expression of TreR-T.DepositorInsertsFruR-T
TreR-T
UseSynthetic BiologyExpressionBacterialMutationLacI/GalR repressor chimera. TAN DBD with FruR LB…Available SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[RbsR-T,TreR-T]
Plasmid#60776PurposeContains PIq driving expression RbsR-T, and PI driving expression of TreR-T.DepositorInsertsRbsR-L
TreR-T
UseSynthetic BiologyExpressionBacterialMutationLacI/GalR repressor chimera. TAN DBD with RbsR LB…Available SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[RbsR-T,LacI-T]
Plasmid#60767PurposeContains PIq driving expression RbsR-T, and PI driving expression of TreR-L.DepositorInsertsRbsR-L
Dimeric LacI with the TAN DBD
UseSynthetic BiologyExpressionBacterialMutationDimeric LacI with the TAN DBD. and LacI/GalR repr…Available SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-Pgc-1alpha-EYFP
Plasmid#241793PurposeExpression vector for mouse Pgc-1alpha with EYFPDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEK42
Plasmid#214958PurposeEndogenous tagging of B. dendrobatidis GAPDH with a red fluorescent protein, hygromycin B selectionDepositorInsertsBdGAPDH_LHA2-G4S-HsmRuby3-ScADH1ter
SpH2Bpro-Hshph-BdGAPDH_RHA2
UseBd gene targeting vectorExpressionBacterialPromoterSpH2BproAvailable SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEK48
Plasmid#214964PurposeEndogenous tagging of B. dendrobatidis Myo17D with a red fluorescent protein, hygromycin B selectionDepositorInsertsBdMyo17D_LHA-G4S-HsmRuby3-ScADH1ter
SpH2Bpro-Hshph-BdMyo17D_RHA
UseBd gene targeting vectorExpressionBacterialPromoterSpH2BproAvailable SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_mouseH3.1
Plasmid#244241PurposeExpresses SpCas9 and a sgRNA targeting the mouse histone H3.1 loci for knock-in.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_H3.2
Plasmid#244239PurposeExpresses SpCas9 and a sgRNA targeting the human histone H3.2 loci for knock-in.DepositorUseCRISPRExpressionMammalianPromoterU6Available SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K519TAG)-HA
Plasmid#239775PurposeExpresses rat NF186 with a TAG codon at position 519 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only