We narrowed to 4,490 results for: GCA
-
Plasmid#122290PurposeKnockdown for mouse Hmga2DepositorAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pHOXB13.1.0-gDNA
Plasmid#113782PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor HOXB13DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZFP3.1.0-gDNA
Plasmid#113779PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZFP3DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF215.1.0-gDNA
Plasmid#113771PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF215DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF250.1.0-gDNA
Plasmid#112479PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF250DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF408.2.0-gDNA
Plasmid#112419PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF408DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pLRK36
Plasmid#253105PurposeExpresses SpCas9-P2A-RUBY under ZmUbi1 promoter and two gRNAs for targeting NAC21/22 genes in wheatDepositorInsertSpCas9-P2A-RUBY
UseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbi1Available SinceMay 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLRK35
Plasmid#253104PurposeExpresses SpCas9-P2A-RUBY under ZmUbi1 promoter and two gRNAs for targeting DND2 genes in wheatDepositorInsertSpCas9-P2A-RUBY
UseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbi1Available SinceApril 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgFDX1-1
Plasmid#251679PurposegRNA to knock out FDX1 in mammalian cellsDepositorInsertFDX1 ferredoxin 1 (FDX1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX459-Fzd7 gRNA
Plasmid#246566PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd7 gRNADepositorAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Fzd4 gRNA
Plasmid#246563PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd4 gRNADepositorAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-sgRXRa4-1; EF1a-mScarlet
Plasmid#242889PurposeFor lentiviral Crispr/Cas9 mediated knockout of mouse RXRa, using a guide RNA against exon 4, coupled to EF1a-driven mScarletDepositorInsertsgRNA targeting Rxra
UseCRISPR and LentiviralTagsmScarletExpressionMammalianPromoterU6Available SinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Pdha1 Donor;3xV5 KO;Mff
Plasmid#240301PurposeKI:Pdha1 Donor:3xV5 KO:MFFDepositorInsertKI gRNA for Pdha1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Lmnb1 Donor;3xV5 KO;Mecp2
Plasmid#240298PurposeKI:Lmnb1 Donor:3xV5 KO:Mecp2DepositorInsertKI gRNA for Lmnnb1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Lmnb1 Donor;3xV5 KO;Rbfox3
Plasmid#240299PurposeKI:Lmnb1 Donor:3xV5 KO:NeuNDepositorInsertKI gRNA for Lmnnb1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(B)
Plasmid#236040PurposeThe plasmid pQdCas12a.sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL649
Plasmid#231164PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlHAIRLESSDepositorInsertmobile gRNA targeting SlHAIRLESS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL518
Plasmid#231160PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlPDSDepositorInsertmobile gRNA targeting SlPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only