We narrowed to 14,223 results for: Cas9
-
Plasmid#91879PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Ezh2DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA targeting Ezh2 (Ezh2 Mouse)
UseCRISPRExpressionMammalianPromoterU6Available sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
G1397 DddAtox-C–dSpCas9
Plasmid#157836Purposeexpresses split DddAtox-Cas9 construct in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertbpNLS–G1397 DddAtox-C–dSpCas9–UGI–UGI–bpNLS
UseCRISPRAvailable sinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#2
Plasmid#107730PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMAPRE3 gRNA #2 (targets Exon 1) (MAPRE3 Human)
ExpressionMammalianPromoterU6Available sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#1
Plasmid#107729PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMAPRE3 gRNA #1 (targets Exon 1) (MAPRE3 Human)
ExpressionMammalianPromoterU6Available sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pZac2.1 EFs-SaCas9-U6-Sa DMDR7-U6-SaDMDL2
Plasmid#78607PurposeA single vector AAV-Cas9 system containing SaCas9 under EFs promoter, gRNAs targeting Dmd introns 22 and 23DepositorInsertEFs-SaCas9-U6-Sa DMDR7-U6-SaDMDL2
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoterEF1a-short; U6Available sinceSept. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCC_08 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-dxCas9NG-NLS-VPR-2A-Puro-WPRE
Plasmid#139093PurposeExpresses human codon-optimized inactive xCas9-NG fused to a transcriptional activator VPR in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertdxCas9-NG-VPR
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840A, A262T,R324L, S409I, E480K, E543D, M6…Available sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-TBK1-gRNA (PX459)
Plasmid#221550PurposeExpresses Cas9 and gRNA for disruption of TBK1 gene in human cellsDepositorAvailable sinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dCas9-KRAB-gRNA-TRE-blast
Plasmid#201152PurposeLentiviral expression of S. pyogenes dead Cas9 (dCas9/dSpCas9/SpdCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsdCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAMutationgRNA sequence: TACGTTCTCTATCACTGATAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CHyMErA.v2_U6(SpCas9_I-SceI)-(AsCas12a(dual-gRNA)_PacI-PacI)_PGK-puro
Plasmid#189636PurposeLentiviral expression of single SpCas9 and dual AsCas12a gRNAs for generating combinatorial CHyMErA.v2 3Cs librariesDepositorInserthU6 Cas9-Cas12a-Cas12a gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable sinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9(LWKYQS)-P2A-EGFP (AHK404)
Plasmid#223113PurposepCMV and pT7 Human expression plasmid for ABE8e using SpCas9 enzyme with LWKYQS amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman codon optimized TadA8e-SpCas9(LWKYQS)-P2A-EGFP
UseCRISPRTagsBPNLS-P2A-EGFP and BPNLS-TadA8eExpressionMammalianMutationTadA8e mutations; nSpCas9(D10A/LWKYQS)=D1135L, S1…PromoterCMV and T7Available sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCC_04 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-xCas9NG-NLS-2A-Puro-WPRE
Plasmid#139089PurposeExpresses human codon-optimized xCas9-NG nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertxCas9-NG
UseCRISPR and LentiviralExpressionMammalianMutationA262T,R324L, S409I, E480K, E543D, M694I, L1111R, …Available sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLGR002 LGR Cas9 guide vector
Plasmid#188320PurposeUniversal backbone for CRISPR/Cas9 sgRNA expressionDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsPuroR-T2A-mTagBFP2ExpressionMammalianPromoterpU6 5'CMV and EF1-alphaAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AOI-WT-Cas9-sg-mouse Suz12-F1-GFP
Plasmid#91881PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA targeting Suz12 (Suz12 Mouse)
UseCRISPRExpressionMammalianPromoterU6Available sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-CFTR gRNA (SpyCas9 scaffold)
Plasmid#113042PurposeAAV vector; encodes GFP as well as a U6-driven CFTR-targeting gRNA (SpyCas9 scaffold)DepositorInsertCFTR gRNA (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable sinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-CCR5 gRNA (SpyCas9 scaffold)
Plasmid#113041PurposeAAV vector; encodes GFP as well as a U6-driven CCR5-targeting gRNA (SpyCas9 scaffold)DepositorInsertgRNA CCR5 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable sinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lv EF1a MS2-Fkbp2x 2A Hygro
Plasmid#102807PurposeLentiviral plasmid from FIRE-Cas9 system to express MS2-Fkbp2x fusion proteinDepositorInsertMS2-Fkbp2x
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable sinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-hSt3Cas9 (pXK-1721)
Plasmid#208828PurposeCRISPR/hSt3Cas9 expression vector for Animal gene editing, harboring the humanized St3Cas9 gene and the corresponding optimized SP1.gRNA. Key Construct: mU6- SP1.gRNA-CMV-hSt3Cas9.DepositorTypeEmpty backboneUseCRISPR; Stcas9ExpressionMammalianPromoterCMVAvailable sinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only