We narrowed to 12,197 results for: SHA;
-
Plasmid#74380PurposeLentiviral expression vector containing flag tagged S155,172A MFF isoform 5 mutantDepositorInsertFlag-MFF (MFF Human)
UseLentiviralTagsFlagExpressionMammalianMutationSer 155 Ala, Ser 172 Ala (Numbering based on MFF …Available SinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti.PGK.blast-Flag-MFF-S155,172E
Plasmid#74443PurposeLentiviral expression vector containing flag tagged S155,172E MFF isoform 5 mutantDepositorInsertFlag-MFF (MFF Human)
UseLentiviralTagsFlagExpressionMammalianMutationSer 155 Glu, Ser 172 Glu (Numbering based on MFF …Available SinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQCXIB Flag MFF S155,172A
Plasmid#74387PurposeRetroviral expression vector containing Flag tagged S155,172A MFF isoform 5 mutantDepositorInsertFlag-MFF (MFF Human)
UseRetroviralTagsFlagExpressionMammalianMutationSer 155 Ala, Ser 172 Ala (Numbering based on MFF …PromoterCMVAvailable SinceMay 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
mHDAC7-Nterm (23-504) pEF6-V5
Plasmid#73270PurposeExpression of mouse HDAC7-Nterm in mammalian cells (V5 tag)DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
mHDAC7-Unspliced (23-938) pEF6-Flag (MJS_018)
Plasmid#73269PurposemHDAC7-U (23-938) pEF6-V5 (MJS_017) (Flag tag)DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQCXIB Flag MFF S155A
Plasmid#74385PurposeRetroviral expression vector containing Flag tagged S155A MFF isoform 5 mutantDepositorInsertFlag-MFF (MFF Human)
UseRetroviralTagsFlagExpressionMammalianMutationSer 155 Ala (numbering based on MFF isoform 1)PromoterCMVAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQCXIB Flag MFF S172A
Plasmid#74386PurposeRetroviral expression vector containing Flag tagged S172A MFF isoform 5 mutantDepositorInsertFlag-MFF (MFF Human)
UseRetroviralTagsFlagExpressionMammalianMutationSer 172 Ala (numbering based on MFF isoform 1)PromoterCMVAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-RASA1-3'UTR
Plasmid#62575PurposeTranslational Luciferase Reporter containing a 926 bp fragment of the RASA1 3'UTR.DepositorAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-M100/125/147/213-siResist
Plasmid#49858PurposeEncodes human connexin 43 with M100, M125, M147, and M213 mutated to L and wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
ExpressionMammalianMutationMethionine100, Methionine 125, Methionine 147, an…PromoterCMVAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GeNL_SS
Plasmid#244128PurposeSensor scaffold luciferase derived from Oplophorus luc.DepositorInsertGeNL_SS
ExpressionMammalianAvailable SinceFeb. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CaBLAM_294W
Plasmid#244130PurposeLower affinity variant of CaBLAM bioluminescent calcium indicatorDepositorInsertCaBLAM_294W
ExpressionMammalianMutationCalmodulin N98WAvailable SinceFeb. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CaBLAM_332W
Plasmid#244131PurposeHigher affinity variant of CaBLAM bioluminescent calcium indicatorDepositorInsertCaBLAM_332W
ExpressionMammalianMutationCalmodulin Q135WAvailable SinceFeb. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Lyn-SH2-AviTag
Plasmid#214207PurposeBacterial expression of SH2 domain of the Lyn kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-TEV-Grb2-SH2-mCherry-AviTag
Plasmid#214231PurposeBacterial expression of SH2 domain of the Grb2 with N-terminal TEV-cleavable 6xHis tag, C-terminal mCherry, and C-terminal AviTag for Streptavidin bead functionalization for binder selections.DepositorInsertGrb2 SH2 domain (GRB2 Human)
Tags6xHis, AviTag, and mCherryExpressionBacterialPromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Lck-SH2-AviTag
Plasmid#214203PurposeBacterial expression of SH2 domain of the Lck kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorInsertLck kinase SH2 domain (LCK Human)
Tags6xHis, AviTag, and SUMOExpressionBacterialPromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Blk-SH2-AviTag
Plasmid#214204PurposeBacterial expression of SH2 domain of the Blk kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorInsertBlk kinase SH2 domain (BLK Human)
Tags6xHis, AviTag, and SUMOExpressionBacterialPromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Hck-SH2-AviTag
Plasmid#214206PurposeBacterial expression of SH2 domain of the Hck kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-HP1γ-ΔCSD-EGFP
Plasmid#179934PurposeC terminal fusion of EGFP to mouse HP1γ (Cbx3) containing deletion of entire chromoshadow domain (ΔCSD)DepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_hnRNPA1_allW
Plasmid#224252PurposeBacterial expression of N-terminally 6His-tagged hnRNPA1_allWDepositorInserthnRNPA1_allW (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationF17W,F25W,F31W,F37W,F43W,Y52W, Y59W, F62W, F69W, …PromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only