We narrowed to 28,253 results for: tat
-
Plasmid#60789PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains ATP2B1 3' UTR and mutated miR-155 sitesDepositorInsertATP2B1 3'UTR and mutated miR-155 binding site (ATP2B1 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-D614G-N501Y
Plasmid#171748PurposeMammalian expression of SARS-CoV-2 Spike protein S-GSAS-D614G-N501Y variantDepositorInsertSpike (S-GSAS-D614G-N501Y variant) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-D614G-I692V
Plasmid#171746PurposeMammalian expression of SARS-CoV-2 Spike protein S-GSAS-D614G-I692V variantDepositorInsertSpike (S-GSAS-D614G-I692V variant) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-D614G-Y453F
Plasmid#171745PurposeMammalian expression of SARS-CoV-2 Spike protein S-GSAS-D614G-Y453F variantDepositorInsertSpike (S-GSAS-D614G-Y453F variant) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mINSIG2
Plasmid#60799PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains INSIG2 3' UTR and mutated miR-155 sitesDepositorInsertINSIG2 3'UTR and mutated miR-155 binding site (INSIG2 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mELOVL6
Plasmid#60791PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains ELOVL6 3' UTR and mutated miR-155 sitesDepositorInsertELOVL6 3'UTR and mutated miR-155 binding site (ELOVL6 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
Tom20-mChF-AIP(TD)
Plasmid#61521PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry, Tom20, and AIP with TD mutationDepositorInsertFK506 binding protein 1A (FKBP1A Human)
TagsAIP with TD mutation (see comments), Tom20, and m…ExpressionMammalianMutationTD mutation (see comments)PromoterCMVAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mLMBRD2
Plasmid#60801PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains LMBRD2 3' UTR and mutated miR-155 sitesDepositorInsertLMBRD2 3'UTR and mutated miR-155 binding site (LMBRD2 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ashL344P-mKate2-splitmVenusN
Plasmid#69586PurposeExpresses mutated p53-L344P tagged with mKate2 and split N-term mVenusDepositorInsertp53-L344P (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - N termExpressionMammalianMutationp53 L344P mutation that prevents dimerization and…PromoterEF1alphaAvailable SinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-FLAG-CHD5-Y619E-FRAG
Plasmid#68871PurposeMammalian expression of CHD5 histone binding domain (331-672aa) with Y619 mutationDepositorAvailable SinceNov. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt206B
Plasmid#34600DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-206 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-eHGT_78h-Cre_PEST
Plasmid#231791PurposeExpresses Cre in excitatory neurons; Cre expression is attenuated by PEST sequence.DepositorInsertCre
UseAAVTagsPESTPromoterminBetaGlobinAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)
Plasmid#215451PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF)DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
A1-LCD allW D262V
Plasmid#234616PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) D262V with all aromatic amino acids mutated to W keeping the hexapeptide fibril core (SYNDFG) intact.DepositorInserthnRNPA1_LCD_allW D262V (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationC-terminal domain (186-320) bearing familial ALS …PromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD allW D262N
Plasmid#234615PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) D262N with all aromatic amino acids mutated to W keeping the hexapeptide fibril core (SYNDFG) intact.DepositorInserthnRNPA1_LCD_allW D262N (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationC-terminal domain (186-320) bearing familial ALS …PromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
AID-C12*-n'Cas9-BE4max
Plasmid#216730PurposeExpresses a BE4max base editing construct comprised of the hyperactive AID-C12* and n'Cas9 (Cas9 with H840A mutation) in mammalian cells.DepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD M1601E
Plasmid#169828PurposeExpresses C-terminal flag-tagged CAD with mutation at reported dimerization interface of the DHOase domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationM1601E; TCCC -> AGTC silent mutations at nt527…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD S1859E
Plasmid#169822PurposeExpresses C-terminal flag-tagged CAD with mutation of reported S6K phosphorylation siteDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationS1859E; TCCC -> AGTC silent mutations at nt527…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX304-BCL-XL-499R
Plasmid#203574PurposeExpresses V5-tagged BCL-XL with resistance to shRNA (TRCN0000033499) in mammalian cells.DepositorInsertBCL2L1 (BCL2L1 Human)
UseLentiviralTagsV5- taggedExpressionMammalianMutationsilent point mutations introduced to make it resi…PromoterCMVAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only