We narrowed to 51,136 results for: des.1
-
Plasmid#11376DepositorInsertmiR-181a-1
UseRNAi and RetroviralExpressionMammalianAvailable SinceJuly 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLVX-FLAG-mCherry-C1-centrin-1
Plasmid#73333PurposeLentiviral vector encoding centrin-1 with N-terminal FLAG and mCherry tagsDepositorInsertcentrin-1 (CETN1 Human)
UseLentiviralTagsFLAG and mCherryExpressionMammalianPromoterCMVAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV p16 Neo (w111-1)
Plasmid#22260DepositorAvailable SinceJan. 4, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hARAF-shRNA-1
Plasmid#185370PurposeFor tetracycline-inducible mammalian expression of shRNA: GCCGTGACCAGATTATCTTTA that targets human ARAFDepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAM-35s-CERK1 D441V-YFPc-1
Plasmid#102403Purposesplit YFP. Plant expression of CERK1 D441V-YFPc-1DepositorAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSR23: pET-SUMO-USP21 (1-565)
Plasmid#240189PurposeBacterial expression for USP21 (1-565)DepositorAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral human Citron shRNA 1 GFP
Plasmid#155286PurposeLentiviral expression of human CIT shRNA, GFP expression, based on Addgene 12247DepositorInsertCitron (CIT Human)
ExpressionMammalianAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
Myc var 1 K396/397 to NQ
Plasmid#127286PurposeExpresses Myc with putative Ub site mutatedDepositorInsertMyc (NM_001177352) (Myc Mouse)
ExpressionMammalianMutationK396 and 397 to N and Q by Q5 mutagenesiPromoterCMVAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1, 17
Plasmid#87893Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1, 17 (DYSF Human)
ExpressionBacterialMutationalternative isoforms, see commentsAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1, 5a
Plasmid#87890Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1, 5a (DYSF Human)
ExpressionBacterialMutationalternative isoforms, see commentsAvailable SinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV/TO RasV12 Puro (w119-1)
Plasmid#22262DepositorAvailable SinceDec. 15, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1-GST-CD(Cbx7)
Plasmid#82525PurposeExpresses GST-CD (Cbx7) fusion proteins in E. coli. Cbx7 chromodomain only; amino acids 1–62.DepositorInsertChromobox Homolog 7 (CBX7 Human)
TagsGSTExpressionBacterialMutationCD(Cbx7) ; amino acids 1–62Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRab-3::Cerulean-Venus::Lgg-1
Plasmid#68045PurposeLgg-1 tagged with oxCerulean-oxVenus (dFP, or double fluorescent protein), expressed in the neurons, for monitoring autophagyDepositorInsertpRab-3::Cerulean-Venus::Lgg-1
ExpressionWormAvailable SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1 EGFP-Sumo2 GG
Plasmid#13384DepositorInsertSumo2 GG (SUMO2 Human)
TagsEGFP and GSTExpressionBacterialMutationMature SUMO2GG: diglycine at amino acid positions…Available SinceNov. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hRAF1-shRNA-1
Plasmid#185371PurposeFor tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEft-3::oxCerulean-oxVenus::Lgg-1
Plasmid#68040PurposeLgg-1 tagged with oxCerulean-oxVenus (dFP, or double fluorescent protein), expressed ubiquitously, for monitoring autophagyDepositorInsertpEft-3::oxCerulean-oxVenus::Lgg-1
ExpressionWormAvailable SinceAug. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDpy-7::oxCerulean-oxVenus::Lgg-1
Plasmid#68042PurposeLgg-1 tagged with oxCerulean-oxVenus (dFP, or double fluorescent protein), expressed in hypodermis, for monitoring autophagyDepositorInsertpDpy-7::oxCerulean-oxVenus::Lgg-1
ExpressionWormAvailable SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pVha-6::oxCerulean-oxVenus::Lgg-1
Plasmid#68041PurposeLgg-1 tagged with oxCerulean-oxVenus (dFP, or double fluorescent protein), expressed in intestines, for monitoring autophagyDepositorInsertpVha-6::oxCerulean-oxVenus::Lgg-1
ExpressionWormAvailable SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMyo-2::oxCerulean-oxVenus::Lgg-1
Plasmid#68043PurposeLgg-1 tagged with oxCerulean-oxVenus (dFP, or double fluorescent protein), expressed in the pharynx, for monitoring autophagyDepositorInsertpMyo-2::oxCerulean-oxVenus::Lgg-1
ExpressionWormAvailable SinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
HIV-1 integrase W235F in pET-15b
Plasmid#61681PurposeHIV-1 integrase W235F in pET-15bDepositorInsertHIV-1 integrase W235F
TagsHisMutationW235FPromoterT7Available SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only