We narrowed to 7,128 results for: trac
-
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationG44SPromoterAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGS_128
Plasmid#160651PurposeExpresses Human APOE3 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoterDepositorInsertApolipoprotein E e3 (APOE Human)
UseTagsKar2 signal sequenceExpressionYeastMutatione3 allelePromoterpZ estradiol inducible promoterAvailable sinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBrain-ch-TOGKDP-GFP-shch-TOG
Plasmid#69113PurposeDual-promoter plasmid to express knockdown-proof human ch-TOG tagged with EGFP along with shRNA to knock down endogenous ch-TOG in mammalian cells.DepositorInsertsUseRNAiTagsEGFPExpressionMammalianMutationSilent mutations to confer shRNA resistance.PromoterCMVAvailable sinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGS_101
Plasmid#160541PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoterDepositorInsertApolipoprotein E e4 (APOE Human)
UseTagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterGAL1Available sinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGS_107
Plasmid#160650PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoterDepositorInsertApolipoprotein E e4 (APOE Human)
UseTagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterGAL1Available sinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-M13-6His-KIF1C-GFP
Plasmid#130975PurposeExpression of 6His-KIF1C-GFP in insect cells for protein purification.DepositorInsertKIF1C-GFP (KIF1C Human)
UseTags6His and GFPExpressionInsectMutation5 silent mutations that make this construct RNAi …PromoterPolyhedrinAvailable sinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
tetO-HAND2
Plasmid#170690Purposedoxycycline-inducible overexpression of HAND2DepositorInsertHAND2 (HAND2 Human)
UseLentiviral; Doxycycline inducibleTagsExpressionMammalianMutationPromoterTRE promoter, Tet-ONAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGS_129
Plasmid#160652PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoterDepositorInsertApolipoprotein E e4 (APOE Human)
UseTagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterpZ estradiol inducible promoterAvailable sinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-MARCer-Blast
Plasmid#160550Purposelabeling hypoxic cellsDepositorInsertMARCer (HIF1A Human)
UseLentiviralTagseGFP-CreExpressionMutationPromoterCMVAvailable sinceDec. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlpha15-RLuc8
Plasmid#140984PurposeEncodes a G alpha subunit (GNA15) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlpha15-RLuc8 (GNA15 Human)
UseLuciferaseTagsExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1755 - pcDNA3.1 CMV-IE hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201819PurposeA plasmid expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a CMV promoterDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseTagsExpressionMammalianMutationPromoterpOTTC1751Available sinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphaQ-RLuc8
Plasmid#140982PurposeEncodes a G alpha subunit (GNAQ) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphaQ-RLuc8 (GNAQ Human)
UseLuciferaseTagsExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag Cl-sensitive YFP hNKCC1 WT (NT13)
Plasmid#49060PurposeExpresses human NKCC1 with an N-terminal 3xFlag-YFP-(chloride-sensing) tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
UseTags3x Flag and YFP (chloride-sensitive)ExpressionMammalianMutationCl-sensitive YFP (EYFP/ V163S A206K) in hNKCC1 in…PromoterCMVAvailable sinceNov. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLV-miRFP680-NES-p2A-ezrin-mRuby3-IRES-Neo
Plasmid#222636PurposeEzrin activation reporterDepositorInsertmiRFP680-NES-p2A-ezrin-mRuby3 (EZR Human)
UseLentiviralTagsmRuby3ExpressionMutationPromoterEF1aAvailable sinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
tetO-NR2F1
Plasmid#170698Purposedoxycycline-inducible overexpression of NR2F1DepositorInsertnuclear receptor subfamily 2 group F member 1 (NR2F1 Human)
UseLentiviral; Doxycycline inducibleTagsExpressionMammalianMutationdeletion of 36G- please see depositor commentsPromoterTRE promoter, Tet-ONAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHOT-P2Y2R
Plasmid#159108Purposeentiviral vector encoding P2Y purinoceptor 2 (P2Y2R), a high affinity G-protein coupled receptor that mobilizes Ca2+ from intracellular stores upon binding extracellular ATP.48,49 By using the GibsonDepositorInsertP2Y2R
UseLentiviralTagsExpressionMutationPromoterUBCAvailable sinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
alpha actinin delta ABD-GFP
Plasmid#66935PurposeMammalian expression of alpha actinin with actin binding domain (amino acids 30–253) deletedDepositorInsertAlpha-actinin 1 (ACTN1 Human)
UseTagsGFPExpressionMammalianMutationactin binding domain (amino acids 30–253) is dele…PromoterCMVAvailable sinceJune 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pINTO-N3::hTET3
Plasmid#136364PurposeExpresses epitope-tagged human TET3 WT in mammalian cellsDepositorInsertTET3 (TET3 Human)
UseTags2xStrep-tagII, FLAG, and HAExpressionMammalianMutationPromoterAvailable sinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphaGustducin-RLuc8
Plasmid#140979PurposeEncodes a G alpha subunit (GNAT3) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphaGustducin-RLuc8 (GNAT3 Human)
UseLuciferaseTagsExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
His-PHD2-181-426
Plasmid#223551PurposeHis-tagged human PHD2 catalytic domain with TEV cleavage site between His and PHD2 for PHD2 purificationDepositorInsertPHD2 (EGLN1 Human)
UseTags6x HisExpressionBacterialMutationDeleted amino acids 1-180.PromotertrcAvailable sinceSept. 23, 2024AvailabilityAcademic Institutions and Nonprofits only