We narrowed to 10,927 results for: cat.1
-
Plasmid#179356PurposeshRNA suppressionDepositorInsertB56γ
UseLentiviralExpressionMammalianPromoterAge1Available SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR207-SD3(1-50)
Plasmid#44587PurposeGateway entry vector for N-terminal fragment (1-50) of SD3 proteinDepositorInsertSD3(1-50)
Available SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMAL-c5X-GLP-1
Plasmid#66997PurposeExpresses malE-GLP-1 in E. coliDepositorInsertmalE-GLP-1
TagsHis6 and malE-Factor XaExpressionBacterialPromotertacAvailable SinceJan. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
IgM (exon 1-3)
Plasmid#11301DepositorInsertIgM (ighm Zebrafish)
ExpressionBacterialAvailable SinceFeb. 14, 2006AvailabilityAcademic Institutions and Nonprofits only -
ZO-1 shRNA 3253
Plasmid#37206DepositorAvailable SinceAug. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
hTspan12(1-305)-1D4_pTT5
Plasmid#216381PurposeMammalian expression vector to transiently express full-length human Tspan12 with a Rho1D4 tagDepositorAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMW-PahZ1 KT-1
Plasmid#141134PurposeExpresses in BL-21 (DE3) cells to produce the poly(aspartic acid) hydrolase-1 from Sphingomonas Sp. KT-1 which selectively cleaves the beta linkages in thermally synthesized poly(aspartic acid).DepositorInsertPahZ1
Tags6x HisExpressionBacterialMutationNot the full-length gene. PahZ1 fragment starts a…Available SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
BtARR3 short (1-392)
Plasmid#236272PurposeBacterial expression of bovine arrestin-3 short (1-392) L393StopDepositorAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-cfRab11a_2
Plasmid#26710DepositorInsertdog Rab11a RNAi
UseLentiviral and RNAiExpressionMammalianMutationDog Rab11a RNAi.Available SinceDec. 15, 2010AvailabilityAcademic Institutions and Nonprofits only -
pRS424-TUB2 (1-428)
Plasmid#60395PurposeExpression of yeast beta tubulin (TUB2) - without Cterminal tail using GAL promoterDepositorInsertTUB2
ExpressionYeastMutationdeleted 429 - endPromoterGALAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
BtARR2 long (1-393)
Plasmid#236270PurposeBacterial expression of bovine arrestin-2 long isoform (1-393) Q394StopDepositorAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR2 long (1-382)
Plasmid#236269PurposeBacterial expression of bovine arrestin-2 long isoform (1-382) D383StopDepositorAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
dSp-p65 (1-100)
Plasmid#99660PurposeExpresses dSp Cas9 fused to truncated p65 activation domainDepositorArticleInsertdCas9
Tagstruncated p65 activation domain (1-100)ExpressionMammalianMutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
dSp-p65 (1-200)
Plasmid#99658PurposeExpresses dSp Cas9 fused to truncated p65 activation domainDepositorArticleInsertdCas9
Tagstruncated p65 activation domain (1-200)ExpressionMammalianMutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
dSp-p65 (1-150)
Plasmid#99659PurposeExpresses dSp Cas9 fused to truncated p65 activation domainDepositorArticleInsertdCas9
Tagstruncated p65 activation domain (1-150)ExpressionMammalianMutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-CDS
Plasmid#136043PurposeUPF3A shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCAGAAACCATTCTAAAGAAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Clover-Geminin(1-110)
Plasmid#83915PurposeFluorescent probe for M/G1 transitionDepositorInsertClover-Geminin(1-110)
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCtnnd2.1-GFP
Plasmid#209095PurposeGFP expressing shRNA targeting Ctnnd2 N-terminusDepositorInsertshCtnnd2.1
Available SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCdh20.1 GFP
Plasmid#209106PurposeGFP expressing scramble of shRNA targeting Cdh20DepositorInsertscrCdh20.1
Available SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPROEX Hsp104 (1-575)
Plasmid#1318DepositorInsertHsp104 (1-575) (HSP104 Budding Yeast)
Tags6X His + TEV cleavageExpressionBacterialMutationaa1-575 of Hsp104Available SinceJan. 21, 2005AvailabilityAcademic Institutions and Nonprofits only -
EGFP-1-SAC1deltaTMD-Fis1tail
Plasmid#220077PurposeSAC1 with the TMD deleted and replaced with the Fis1tail to replace the TMD and target the mitochondria instead of the ER with a Green FluorophoreDepositorAvailable SinceMay 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBS-beta1,4 GT-1
Plasmid#11872DepositorInsertbeta 1,4 galactosyltransferase (B4GALT1 Human)
ExpressionBacterialAvailable SinceMay 12, 2006AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - DDX3Y sgRNA 1
Plasmid#70656PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a DDX3Y targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against DDX3Y
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCdh2.1 GFP
Plasmid#209100PurposeGFP expressing scramble of shRNA targeting Cdh2DepositorInsertscrCdh2.1
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-HHARI(1-185)
Plasmid#17341DepositorAvailable SinceFeb. 19, 2008AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C3orf17 sgRNA 1
Plasmid#70652PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C3orf17 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C3orf17
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
SRF 1-133 pGEX4T1
Plasmid#121101PurposeExpression of SRF fragment as a GST fusion proteinDepositorAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 1
Plasmid#70655PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCdh11.1 GFP
Plasmid#209103PurposeGFP expressing shRNA targeting Cdh11DepositorInsertshCdh11.1
Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCdh2.1 GFP
Plasmid#209099PurposeGFP expressing shRNA targeting Cdh2DepositorInsertshCdh2.1
Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCdh11.1 GFP
Plasmid#209104PurposeGFP expressing scramble of shRNA targeting Cdh11DepositorInsertscrCdh11.1
Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCtnnd2.2-GFP
Plasmid#209098PurposeGFP expressing scramble of shRNA targeting Ctnnd2 3' UTRDepositorInsertscrCtnnd2.2
Available SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCdh10.1 GFP
Plasmid#209101PurposeGFP expressing shRNA targeting Cdh10DepositorInsertshCdh10.1
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCtnnd2.2-GFP
Plasmid#209097PurposeGFP expressing shRNA targeting Ctnnd2 3' UTRDepositorInsertshCtnnd2.2
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCtnnd2.1-GFP
Plasmid#209096PurposeGFP expressing scramble of shRNA targeting Ctnnd2 N terminusDepositorInsertscrCtnnd2.1
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C16orf80 sgRNA 1
Plasmid#70651PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C16orf80 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C16orf80
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBS FGF3 isoform 1
Plasmid#19230DepositorInsertFibroblast growth factor receptor 3 isoform 1 (FGFR3 Chicken)
ExpressionBacterialAvailable SinceSept. 19, 2008AvailabilityAcademic Institutions and Nonprofits only -
pWay21-MKP-1 FL
Plasmid#13469DepositorAvailable SinceJan. 25, 2007AvailabilityAcademic Institutions and Nonprofits only -
p40phox-PX (1-144)
Plasmid#119123PurposeBacterial expression of human phox homology (PX) domain, p40phox-PX (1-144)DepositorInsertp40phox-PX (1-144)
TagsGSTExpressionBacterialPromotertacAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Level 1 P1 OsActinP:Hygint:NosT
Plasmid#165423PurposeGoldenGate (MoClo) Level 1 Position 1 (Reverse) hygromycin selection cassetteInsertOs Actin promoter :: Hygromycin resistance gene (hpt) containing CAT1 intron :: NosTerminator
UseSynthetic Biology; L1 p1(r) golden gate (moclo) h…PromoterOs Actin promoter :: Hygromycin resistance gene (…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only