We narrowed to 60,551 results for: promoter
-
Plasmid#11916PurposeMammalian expression of Cre recombinase driven by the human cytomegalovirus IE promoterDepositorAvailable SinceJan. 4, 2007AvailabilityAcademic Institutions and Nonprofits only
-
Flag-HA-USP49
Plasmid#22586DepositorAvailable SinceDec. 4, 2009AvailabilityAcademic Institutions and Nonprofits only -
RIP-Timer (DM#285)
Plasmid#15109DepositorInsertinsulin II promoter (Ins2 Rat)
ExpressionMammalianAvailable SinceOct. 18, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-eNpHR 3.0-EYFP
Plasmid#26972PurposeAAV expression of eNpHR 3.0 fused to EYFP driven by humanized Synapsin promoter for optogenetic inhibitionDepositorHas ServiceAAV2 and AAV5InserteNpHR 3.0
UseAAVTagsEYFPExpressionMammalianMutationTrafficking Signal (TS) ER Export SignalPromoterhSynAvailable SinceFeb. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCAG-T7-TALEN(Sangamo)-Destination
Plasmid#37184PurposeDestination vector for Voytas Golden Gate TALEN assembly incorporating a CAG promoter for mammalian expression and a T7 promoter for synthesis of TALEN mRNA. Uses homodimeric FokI domains.DepositorTypeEmpty backboneTagsFokI nucleaseExpressionMammalianPromoterCAGAvailable SinceJuly 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-eNpHR 3.0-EYFP
Plasmid#26971PurposeAAV expression of eNpHR 3.0 fused to EYFP driven by CaMKIIa promoter for optogenetic inhibitionDepositorHas ServiceAAV1 and AAV9InserteNpHR 3.0
UseAAVTagsEYFPExpressionMammalianMutationTrafficking Signal (TS) ER Export SignalPromoterCaMKIIaAvailable SinceFeb. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-tdTomato
Plasmid#28306PurposeCre-dependent AAV-mediated expression of tdTomato under the CAG promoterDepositorHas ServiceAAV PHP.S, AAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InserttdTomato
UseAAV and Cre/Lox; Adeno-associated virusExpressionMammalianMutationN/APromoterCAGAvailable SinceSept. 7, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-mCherry
Plasmid#50459PurposeDouble floxed mCherry under the control of human synapsin promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertmCherry
UseAAVTagsN/APromoterhuman Synapsin 1Available SinceMarch 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCuo CA Rac1
Plasmid#84643Purposeconstitutively active Rac1 under cumate-inducible promoter in Lentiviral vector. Also expresses RFP and puromycin resistance.DepositorInsertRac1 (RAC1 Human)
UseLentiviralExpressionMammalianMutationConstitutively Active, Q61LPromotercumate-inducible promoterAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
Flag-HA-USP45
Plasmid#22605DepositorAvailable SinceDec. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pTRE-8XGTIIC-DsRED-DD
Plasmid#115798Purposelentiviral, trimethoprim (TMP) regulated YAP promoter activity reporterDepositorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP1-sox17 promoter
Plasmid#31400DepositorAvailable SinceOct. 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGL2-356bp
Plasmid#16292DepositorInsertp53 promoter fragment (TP53 Human)
UseLuciferaseExpressionMammalianMutationfragment -344 to +12 relative to first transcript…Available SinceDec. 14, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN
Plasmid#11160PurposeMammalian expression vector for cloning and expressing your gene under the CAG promoterDepositorHas ServiceCloning Grade DNAInsertmodified multiple cloning sites
ExpressionMammalianAvailable SinceApril 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Parkin
Plasmid#23956PurposeMammalian expression of human Park2 fused to mCherryDepositorAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-HTNC
Plasmid#13763PurposeFor expression and purification of a His-TAT-NLS-Cre fusion; HIV-TAT promotes cellular uptake of recombinant Cre into mammalian cells.DepositorInsertHis-TAT-NLS-Cre
UseBaculovirusTagsHis Tag, NLS, and TATExpressionBacterialPromoterp10 promoterAvailable SinceApril 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
Flag-HA-USP50
Plasmid#22588DepositorAvailable SinceDec. 4, 2009AvailabilityAcademic Institutions and Nonprofits only -
phU6-gRNA
Plasmid#53188PurposeExpresses the S. pyogenes sgRNA from the human U6 promoterDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterhuman U6Available SinceJune 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-dCas9/pMXs-puro
Plasmid#51240PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.DepositorInsert3xFLAG-dCas9
UseCRISPR and RetroviralTags3xFLAG tag and NLS (nuclear localization signal)ExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterLTRAvailable SinceAug. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only