We narrowed to 6,121 results for: tTA
-
Plasmid#125782Purposeconstitutive expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN2 (WRN Human)
UseRNAiAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-ACSL3-sfGFP(C) HDR template
Plasmid#129413PurposeHDR tempalte for tagging of endogenous human ACSL3 C-terminus with sfGFPDepositorInsertACSL3 HDR template (ACSL3 Human)
UseCRISPR and TALEN; Endogenous tagging hdr templateTagssfGFPExpressionMammalianAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG_FBXL7 (R310H)
Plasmid#171849PurposepcDNA3-FLAG_FBXL7 (R310H)DepositorInsertF-box and leucine rich repeat protein 7 (FBXL7 Human)
TagsFlagExpressionMammalianMutationchanged Arginine 310 to HistidineAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-mPGK-CD90.2-Rluc_miR
Plasmid#163332PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the murine PGK promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMY-CD90.2-Rluc_miR
Plasmid#163333PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the LTR promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
t1-400
Plasmid#166577PurposeFor expression of human talin head (residues 1-400) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertTln1 Head (1-400) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-400 onlyAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLPC-NMYC-hTRF1deltaBLM
Plasmid#64165PurposeRetroviral vector expressing human TRF1 delta aa317-374 with N-terminal MYC tagDepositorInserthTRF1 (TERF1 Human)
UseRetroviralTagsMycExpressionMammalianMutationdeleted amino acids aa317-374 of human TRF1PromoterCMVAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
TAF1 gRNA (BRDN0001147230)
Plasmid#77869Purpose3rd generation lentiviral gRNA plasmid targeting human TAF1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEMS1494
Plasmid#29242PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle23 (CCKBR Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1593
Plasmid#29270PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle122 (ICMT Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 28, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
TDP-43_CTD_12S→E_S305C/A326P
Plasmid#248868PurposeExpresses MBP-tagged C-terminal domain of TDP-43 with 12S→E, S305C and A326P.DepositorInsertTDP-43_CTD_12S→E_S305C/A326P (TARDBP Human)
Tags6xHis tags-MBPExpressionBacterialMutationchanged S292E, S369E, S377E, S379E, S387E, S389E,…Available SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_13S→E_S317C
Plasmid#248845PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with 13S→E and S317C.DepositorInsertTDP-43_CTD_13S→E_S317C (TARDBP Human)
Tags6xHis-tagsExpressionBacterialMutationchanged S292E, S305E, S369E, S377E, S379E, S387E,…Available SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_13S→E_S273C
Plasmid#248859PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with 13S→E and S273C.DepositorInsertTDP-43_CTD_13S→E_S273C (TARDBP Human)
Tags6xHis-tagsExpressionBacterialMutationchanged S292E, S305E, S369E, S377E, S379E, S387E,…Available SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_12S→E_S305C
Plasmid#248867PurposeExpresses MBP-tagged C-terminal domain of TDP-43 with 12S→E and S305C.DepositorInsertTDP-43_CTD_12S→E_S305C (TARDBP Human)
Tags6xHis tags-MBPExpressionBacterialMutationchanged S292E, S369E, S377E, S379E, S387E, S389E,…Available SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-TBET-T2A-mCHERRY
Plasmid#224296PurposeExpresses mouse TBET and mCherry under EF1a promoterDepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdest myr-AKT2 puro
Plasmid#223053Purposemyr-AKT2 gene expression in mammalian cellsDepositorAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdest METTL1-S27A Neo
Plasmid#223059PurposeMETTL1-S27A gene expression in mammalian cellsDepositorAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdest METTL1-S27D Neo
Plasmid#223060PurposeMETTL1-S27D gene expression in mammalian cellsDepositorAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdest myr-AKT2 Neo
Plasmid#223063Purposemyr-AKT2 gene expression in mammalian cellsDepositorAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only