We narrowed to 9,075 results for: sgRNA
-
Plasmid#245330PurposeCas12a CRISPRa positive control guide; targets CD274, ADGRE5, CD4, DPP4DepositorAvailable sinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pKLV2-U6gRNA5(NR5A2_5-2)-PGKpuroBFP-W
Plasmid#211976PurposeExpress gRNA against NR5A2 with puro and BFPDepositorInsertsgRNA targeting NR5A2 (NR5A2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(NR5A2_5-5)-PGKpuroBFP-W
Plasmid#211977PurposeExpress gRNA against NR5A2 with puro and BFPDepositorInsertsgRNA targeting NR5A2 (NR5A2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(POU5F1_g1)-PGKpuroBFP-W
Plasmid#211980PurposeExpress gRNA against POU5F1 with puro and BFPDepositorInsertsgRNA targeting POU5F1 (POU5F1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(POU5F1_g15-14)-PGKpuroBFP-W
Plasmid#211981PurposeExpress gRNA against POU5F1 with puro and BFPDepositorInsertsgRNA targeting POU5F1 (POU5F1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
GuideVector_BbsI
Plasmid#110692PurposeFor rapid cloning and expression of sgRNAs in mammalian cells. Contains copGFP for easy FACS sorting.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH
Plasmid#131683PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g1 (BB22)
Plasmid#139457PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-NCOA7g1 (BB34)
Plasmid#139452PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g2 (BB23)
Plasmid#139458PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
Reckleen_2_SpGCas9
Plasmid#233457PurposeLevel 2 RECKLEEN plasmid, genome editing of Klebsiella pneumoniaeDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLevel 2 RECKLEEN plasmid
UseCRISPRAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Usp5
Plasmid#174873PurposeCRISPR vector for generating Usp5 STREAMING-tag KI cellDepositorInsertsgRNA for mouse Usp5 (Usp5 Synthetic)
UseCRISPRAvailable sinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Wnk1
Plasmid#174874PurposeCRISPR vector for generating Wnk1 STREAMING-tag KI cellDepositorInsertsgRNA for mouse Wnk1 (Wnk1 Synthetic)
UseCRISPRAvailable sinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJK434
Plasmid#155378PurposePphlF_A4NT, 1x cascade + [dCas9 + PA4-mVenus]. (Integration of 429; pOSIP)DepositorInsertsdCas9 (bacteria)
PA4-mVenus
PphlF_A4NT in dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)Available sinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK430
Plasmid#155377PurposePphlF_A2NT in dCRv1, 2x cascade + [dCas9 + PA4-mVenus]DepositorInsertsdCas9 (bacteria)
PA4-mVenus
PphlF_A2NT in dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)AvailabilityAcademic Institutions and Nonprofits only -
pX330-TAF1-A
Plasmid#247346PurposeExpresses SpCas9 and a sgRNA targeting the human TAF1-A loci for knock-in.DepositorAvailable sinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pW213-lenti-sasgRNA-Esp3I-2kb-filler-pEF1s-NLS-mNeonGreen-P2A-BlastR
Plasmid#170811PurposeLentiviral vector to co-express an sasgRNA with NLS-mNeonGreenDepositorTypeEmpty backboneUseLentiviralExpressionMammalianMutationNAAvailable sinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
L40C-CRISPR.EFS.mNeon
Plasmid#69146PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA (hU6), mNeon coexpression, EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pW188-lenti-spsgRNA-lacZ-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#170813PurposeLentiviral vector to co-express a lacZ control spsgRNA with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR
UseLentiviralExpressionMammalianMutationNAAvailable sinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only