We narrowed to 4,909 results for: Mos
-
Plasmid#141100PurposePlasmid for CRISPR-generated knock-in line that expresses optogenetic activator CsChrimson-tdTomato by knocking-in fragment into the coding sequence of the endogenous Aedes aegypti fru geneDepositorInsertfru-left-HDR-arm; T2A-CsChrimson-tdTomato-SV40; 3xP3-EYFP-SV40; fru-right-HDR-arm
UseDonor templateTagsExpressionMutationPromoterAvailable sinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
JAM2_pLENTI-CAG-IRES-GFP
Plasmid#176997PurposeMammalian lentiviral expression vector encoding JAM2DepositorInsertJAM2 (JAM2 Human)
UseLentiviralTagsExpressionMutationPromoterCAGAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRYZL1_pLENTI-CAG-IRES-GFP
Plasmid#177004PurposeMammalian lentiviral expression vector encoding CRYZL1DepositorInsertCRYZL1 (CRYZL1 Human)
UseLentiviralTagsExpressionMutationPromoterCAGAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
DOP1B_pcDNA6.2/EmGFP-Bsd
Plasmid#176979PurposeMammalian expression vector encoding DOP1B and EmGFP-BsdDepositorInsertDOP1B (DOPEY2 Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
KCNJ15_pcDNA6.2/EmGFP-Bsd
Plasmid#176981PurposeMammalian expression vector encoding KCNJ15 and EmGFP-BsdDepositorInsertKCNJ15 (KCNJ15 Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRYZL1_pcDNA6.2/EmGFP-Bsd
Plasmid#176941PurposeMammalian expression vector encoding CRYZL1 and EmGFP-BsdDepositorInsertCRYZL1 (CRYZL1 Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 4-178
Plasmid#108284PurposeExpresses residues 4-178 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-279DepositorInsertCHMP1B (CHMP1B Human)
UseTagsGSTExpressionBacterialMutationdeleted amino acids 1-3 and 179-199PromoterAvailable sinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 1-143
Plasmid#108286PurposeExpresses residues 1-143 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-278DepositorInsertCHMP1B (CHMP1B Human)
UseTagsGSTExpressionBacterialMutationamino acids 1-143PromoterAvailable sinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CHMP1B 4-199
Plasmid#115325PurposeExpresses residues 4-199 of CHMP1B from a His-SUMO bacterial expression vector. Internal ID: WISP 18-23DepositorInsertCHMP1B (CHMP1B Human)
UseTagsHis-SUMOExpressionBacterialMutationPromoterAvailable sinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CHMP1B 1-199
Plasmid#115326PurposeExpresses residues 1-199 of CHMP1B from a His-SUMO bacterial expression vector. Internal ID: WISP 18-24DepositorInsertCHMP1B (CHMP1B Human)
UseTagsHis-SUMOExpressionBacterialMutationPromoterAvailable sinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ir7f-T2A-QF2 HDR plasmid
Plasmid#140942PurposePlasmid for CRISPR-generated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment into the coding sequence of the endogenous Aedes aegypti Ir7f geneDepositorInsertIr7f-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir7f-right-HDR-arm
UseTagsExpressionMutation4 point mutations (annotated on plasmid map) were…PromoterAvailable sinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR3-vsv-AuroraB L154A/H250Y
Plasmid#108489Purposeexpression of vsv-AuroraB Analog sensitive (L154A/H250Y)DepositorInsertAuroraB (AURKB Human)
UseTagsVSVExpressionMammalianMutationAnalog sensitive L154A/H250YPromoterCMVAvailable sinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9ExpressionMutationPromoterAvailable sinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + Z-AAT target
Plasmid#86007Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
Z-AAT target
UseLentiviralTagsExpressionMutationV30MPromoterAvailable sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + TTR target
Plasmid#86009Purposelenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
TTR target
UseLentiviralTagsExpressionMutationV30MPromoterAvailable sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I tension sensor (F40-based)
Plasmid#119186PurposeThe F40-based human desmoplakin I tension sensor detects forces in the range of 1-6 pN by changes in FRET between mTFP1 and mEYFP.DepositorInserthuman Desmoplakin I-[mTFP1-F40-mEYFP] (internal-1945) (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterTCEAvailable sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLViN-E-cadherin-GFP
Plasmid#229710PurposeLentiviral expression of E-cadherin-GFPTG in mammalian cellsDepositorInsertCDH1 E-CADHERIN Human (CDH1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationPromoterCMV promoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…PromoterAvailable sinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only