We narrowed to 4,490 results for: GCA
-
Plasmid#165932PurposeCRISPR-mediated gene perturbation (knock-out) of HNRNPDDepositorArticleAvailabilityAcademic Institutions and Nonprofits only
-
pLENTICRISPR-NDUFB5-sgRNA1
Plasmid#165939PurposeCRISPR-mediated gene perturbation (knock-out) of NDUFB5DepositorArticleAvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR-NDUFB5-sgRNA2
Plasmid#165940PurposeCRISPR-mediated gene perturbation (knock-out) of NDUFB5DepositorArticleAvailabilityAcademic Institutions and Nonprofits only -
lenti-hygro-sgMETTL1-6
Plasmid#254417PurposeMammalian expression plasmid encoding an sgRNA targeting human METTL1.DepositorAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pscAAV-U6-gTgfbr2-CBh-mCherry-SV40late
Plasmid#249125Purposeexpression of gTgfbr2 and mCherryDepositorAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hNRP1-gRNA3
Plasmid#249212PurposeNRP1 CRISPR KODepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgETS1-1
Plasmid#251685PurposegRNA to knock out ETS1 in mammalian cellsDepositorInsertETS1 ETS proto-oncogene 1, transcription factor (ETS1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-IF1
Plasmid#206923PurposePlasmid expressing Cas9, GFP and guides to human IF1 to generate IF1-KO mammalian cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 CLUH sg2
Plasmid#244858PurposeKnockout of human CLUHDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_POP5 (pAVA3498)
Plasmid#239315PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting POP5DepositorInsertU6-driven sgRNA targeting POP5 (POP5 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-SOS1(dog)-gRNA2
Plasmid#228756PurposeA knockout vector for dog SOS1.DepositorInsertA gRNA targeting the dog SOS1 gene and the cDNA of CRISPR-Cas9 (SOS1 canis lupus)
ExpressionMammalianAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-KO-2-EF1a-LibVec
Plasmid#239598Purposeexpresses guide#2 to knock-out mouse Plxnb2, via CRISPR-Cas9DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-BRD4-HaloTag-Guide-hspCas9
Plasmid#228576PurposeExpression of Halo-tagged human BRD4 gRNA; CRISPR-mediated gene insertionDepositorAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Puro_hs_TP73
Plasmid#214689PurposeLentiviral expression vector for an inducible Cas9-P2A-Puromycin resistance casette with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralMutationPuromycin resistance cassette has silent mutation…Available SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper DGK zeta human
Plasmid#224575PurposeTo downregulate the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-MYD88-ts2
Plasmid#174281PurposeMYD88 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
rSirt3 shRNA (pLKO.1 vector)
Plasmid#216807PurposeshRNA against rat Sirt3DepositorAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(TAL1(11))-PGKpuro2ABFP-W
Plasmid#208545PurposeLentiviral vector expressing gRNA targeting human TAL1DepositorInsertTAL1(11) (TAL1 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only