We narrowed to 9,861 results for: CAG
-
Plasmid#162249PurposeBlue-light dependent heterodimerization systemDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertp18-eMagB-iRFP
ExpressionMammalianPromoterbeta-actin promoterAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCDNA3 IRF7(5’UTR)-FF
Plasmid#85490PurposeFirefly luciferase under the control of IRF7 5'UTRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert5'UTR of IRF7 (Irf7 Mouse)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable sinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12D/sgKras/Cre
Plasmid#99851PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJT87
Plasmid#204489PurposeCAG promoted WBeta recombinaseDepositorInsertWBeta recombinase
UseSynthetic BiologyExpressionBacterial and MammalianPromoterCAGAvailable sinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT88
Plasmid#204490PurposeCAG promoted phiC31 recombinaseDepositorInsertphiC31 recombinase
UseSynthetic BiologyExpressionBacterial and MammalianPromoterCAGAvailable sinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 2 tet pLKO puro
Plasmid#162984PurposeTet-inducible shRNA targeting human METTL3 #2DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable sinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR4 TNRC6A
Plasmid#20021DepositorInsertTrinucleotide repeat containing 6A (TNRC6A Human)
UseGateway CloningAvailable sinceJan. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA2-gRNA_A
Plasmid#74376PurposegRNA_A to knockout human AMPK alpha 2 using Cas9n.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman AMPK alpha 2 exon1 gRNA (PRKAA2 Human)
UseCRISPRPromoterU6Available sinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pERB221
Plasmid#61502Purposeconst. CenpB-GFP-Halo + mCherry-DHFRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsCenpB-GFP-Halo
mCherry-DHFR
TagsHaloTag and mCherryExpressionMammalianAvailable sinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAVS1-tdTomato targeting vector (compatible with CAGGS-AsCpf1-2A-GFP-U6-AAVS1-sgRNA)
Plasmid#194728PurposeAAVS1-tdTomato targeting vector, compartible with Cpf1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserttdTomato
UseCRISPR; Knockin targeting plasmidAvailable sinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
hAID-BE3 (pRZ352)
Plasmid#131316PurposeCAG promoter expression plasmid for hAID-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthAID-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable sinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
SV40 basal promoter-LacZ
Plasmid#18816DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSV40 basal promoter-LacZ
ExpressionMammalianAvailable sinceJuly 27, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9
Plasmid#184464PurposePlasmid encoding PRDM9-Cas9 fusion under CMV promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9 (PRDM9 Human)
UseCRISPRTagsFLAGExpressionMammalianPromoterCMVAvailable sinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-PIK3C2B
Plasmid#161989PurposeMammalian expression vector containing PIK3C2B tagged with GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPIK3C2B (PIK3C2B Human)
TagsGFPExpressionMammalianMutationsiRNA resistance to siRNA#2 with 4 silent mutatio…Available sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
G10 Cas9 MDC123
Plasmid#59187PurposeG10 promoting Glycing Max codon optimized Cas9 (N and C terminus NLS) with bar plant selectionDepositorInsertGlycine Max codon optimized Cas9
UseCRISPRExpressionPlantPromoterG10Available sinceDec. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF1-3'UTR
Plasmid#136036PurposeUPF1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (TTATTACCCAGAATAAGATGC)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMU-LEr
Plasmid#61185PurposeFluorescent reporter for late endosome mCherry-MtRAB5A2 expressed under AtUBQ10 promoterDepositorInsertMtRAB5A2
TagsmCherryExpressionPlantPromoterAtUBQ10Available sinceFeb. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
K9L mutant of H3K9me3 biosensor
Plasmid#120807PurposeFRET biosensor. Eliminating the H3 lysine 9 methylation site in H3K9me3 biosensor to abolish the detection capabilityDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTruncated YPet-HP1-EV linker-ECFP-mouse histone H3(K9L mutation)
ExpressionMammalianMutationlysine 9 is mutated to leucine 9 on histone H3PromoterCMVAvailable sinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-STAG2 shRNA 3782
Plasmid#31979DepositorAvailable sinceAug. 25, 2011AvailabilityAcademic Institutions and Nonprofits only