We narrowed to 1,308 results for: grna cloning vector
-
Plasmid#239305PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC7DepositorInsertU6-driven sgRNA targeting EXOSC7 (EXOSC7 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC8 (pP18(T)_B1-AVA4071)
Plasmid#239306PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC8DepositorInsertU6-driven sgRNA targeting EXOSC8 (EXOSC8 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC9 (pP18(T)_A7-AVA4072)
Plasmid#239307PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC9DepositorInsertU6-driven sgRNA targeting EXOSC9 (EXOSC9 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_DIS3 (pP18(T)_A5-AVA4073)
Plasmid#239308PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting DIS3DepositorInsertU6-driven sgRNA targeting DIS3 (DIS3 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_C1D (pP18(T)_B9-AVA4070)
Plasmid#239296PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting C1DDepositorInsertU6-driven sgRNA targeting C1D (C1D Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC2 (pP18(T)_C3-AVA4067)
Plasmid#239301PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC2DepositorInsertU6-driven sgRNA targeting EXOSC2 (EXOSC2 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC4 (pP18(T)_C11-AVA4065)
Plasmid#239302PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC4DepositorInsertU6-driven sgRNA targeting EXOSC4 (EXOSC4 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC5 (pP18(T)_B12-AVA4068)
Plasmid#239303PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC5DepositorInsertU6-driven sgRNA targeting EXOSC5 (EXOSC5 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
scAAV-sgRNA-GFP
Plasmid#177935PurposeExpresses sgRNA and can be packaged into AAV particles for somatic delivery into Cas9 transgenic miceDepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianPromoterU6Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
rTTA-gRNA-AAV
Plasmid#213036PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoterDepositorInsertrTTA-T2A-mCherry
UseAAV and CRISPRPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_UPF3A/UPF3B (pAVA3129)
Plasmid#239329PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting UPF3A and UPF3BDepositorInsertU6-driven sgRNA1 targting UPF3A and 7SK-driven sgRNA2 targeting UPF3B (UPF3B Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA-NONO-1
Plasmid#127654PurposeKnock-out of human NONO (guide only)DepositorInsertNONO sgRNA (NONO Human)
ExpressionMammalianAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA
Plasmid#73796PurposepRS416 Ura marked Cen/Ars plasmid with dCas9-Mxi1 under Tef1 promoter, and tet-incucibile RPR1 promoter with NotI cloning site adjacent to gRNADepositorInsertsdCas9-Mxi1
Tet Repressor
Structural gRNA for S pyogenes
UseCRISPRTagsMxi1 and NLSExpressionYeastMutationD10A, H840APromoterpGPM1, pRPR1(TetO), and pTef1Available SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
Guide-Generating Vector
Plasmid#125752PurposeGuide-Generating Vector for creating the Cys4-guide-scaffold structure in the first round of assemblyDepositorInsertCys4-GFPdropout-SpCas9scaffold
UseSynthetic BiologyAvailable SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV_hU6-sgRNA_hUbC-dCas9-ZIM3-KRAB-T2a-PuroR
Plasmid#172982Purposecontrol & cloning vector for CRISPRi expressing dead Cas9-ZIM3-KRAB fusionDepositorInsertcontrol sgRNA
UseCRISPR and LentiviralAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-L858R-T790M-dual-nick sgRNA
Plasmid#214101PurposeLentiviral vector expressing nicking sgRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two sgRNAs using independent U6 promoters.DepositorInsertEGFR L858R nicking sgRNA/EGFR T790M nicking sgRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pW299-lenti-spsgRNA-Esp3I-2kb-filler-pEF1s-NLS-tagBFP-P2A-BlastR
Plasmid#189943PurposeLentiviral vector to co-express an spsgRNA with NLS-tagBFPDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-gRNA hUbC-dSaCas9-KRAB-T2A-Thy1.1
Plasmid#194278PurposeExpresses gRNA and dSaCas9-KRAB from lentiviral vectorDepositorInsertshumanized dSaCas9 KRAB T2A Thy1.1
gRNA
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhU6 and hUbCAvailable SinceJan. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#1
Plasmid#208387PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#1 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only