We narrowed to 17,157 results for: REV
-
Plasmid#1152DepositorAvailable SinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only
-
nuc-yHS1
Plasmid#159166PurposeNuclear labile heme reporterDepositorInsertnuc-yHS1
TagsSV40 NLSExpressionYeastPromoterGPDAvailable SinceSept. 21, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
ZJOM157
Plasmid#133640PurposeIntegration of GFP-PEP12 as an additional copy in genome, use auxotrophic marker URA3(Kluyveromyces lactis).Marker for yeast late endosome.DepositorAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
UASGAL-PCYC
Plasmid#60335PurposeContains a promoter of activating sequence derived from native galactose promoter coupled with a core promoter derived from native Leucine promoter.DepositorInsertpromoter
UseSynthetic Biology; Yeast synthetic hybrid promote…ExpressionYeastAvailable SinceNov. 6, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCEV-G3-Ph
Plasmid#46818PurposeTEF1 and GAL10 promoter controlled expression cassettes with phleomycin resistance for yeast transformationDepositorTypeEmpty backboneTagsFLAG and c-mycExpressionYeastPromoterTEF1 and GAL10Available SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCPP5052
Plasmid#128729PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopAM1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
LHP1048 - pFB-RSP5
Plasmid#32434DepositorAvailable SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pXN-FBLWLF-GAL80
Plasmid#26265DepositorAvailable SinceFeb. 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-NM
Plasmid#1127DepositorAvailable SinceMarch 14, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGEX2TK-Num1-PH
Plasmid#71369Purposebacterial expression of PH domain for phosphoinositide binding assayDepositorInsertNum1-PH
TagsGSTExpressionBacterialMutationPleckstrin homology (PH) domain; aa2563-2692PromotertacAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 gfaABC1D-LifeAct-GFP
Plasmid#190199PurposeExpresses the small actin binding peptide, LifeAct, with a GFP reporterDepositorInsertLifeAct-eGFP
UseAAVTagsGFPExpressionBacterial and MammalianPromotergfaABC1DAvailable SinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCPP5238
Plasmid#128711PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopG1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP3416
Plasmid#128720PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopT1-1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5534
Plasmid#128723PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopX1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
YIplac211-CHS3-msGFPx3
Plasmid#105257PurposePlasmid for pop-in/pop-out replacement of Chs3 with Chs3-msGFPx3.DepositorAvailable SinceFeb. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS314-hUD
Plasmid#11005DepositorInserthUD recombination system
ExpressionBacterial and YeastMutationDirect repeat recombination system. Recombination…Available SinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
Plas-gRNA-Z3EV
Plasmid#157659PurposeGFP gene and gRNA under Z3EV expression control (estradiol sensor), with Z3EV transcription factor to insert in the genome.DepositorInsertGFP-gRNA NatMX Z3EV
UseInsert storage (replicative in e. coli)Available SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only