We narrowed to 9,360 results for: CAG
-
Plasmid#226196PurposeExpression mappingDepositorInsertSyn Barcode19
UseAAVAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode21
Plasmid#226194PurposeExpression mappingDepositorInsertSyn Barcode21
UseAAVAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode18
Plasmid#226191PurposeExpression mappingDepositorInsertSyn Barcode18
UseAAVAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCoHygro L16_shRNA of spliced Copia
Plasmid#71389Purposeknock down expression of spliced Copia in Drosophila melanogasterDepositorInsertCopia
ExpressionInsectPromoterU6Available SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
SGEP-sh-Hs-PHGDH-1957
Plasmid#188674PurposeshRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NQO1
Plasmid#214684PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human NQO1DepositorInsertdgRNA_NQO1 (NQO1 Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWT016i
Plasmid#96856Purposetheophylline-agRNA-GFPDepositorInserttheophylline-agRNA-GFP
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT016l
Plasmid#96857Purpose(d)theophylline-agRNA-GFPDepositorInsert(d)theophylline-agRNA-GFP
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
MYC sgRNA4
Plasmid#100556PurposeExpresses MYC sgRNA4. Target sequence: GTAATTCCAGCGAGAGGCAGDepositorInsertMYC sgRNA4
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
OA-1050G (white)
Plasmid#132420Purposeexpress arrays of gRNA targeting White under dU6-3 promoterDepositorInsertwhite gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCol-TGM-luc.1309
Plasmid#32720DepositorInsertluciferase
UseMouse Targeting and RNAiPromoterTRE and TreAvailable SinceMarch 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTrcHIS2-MtFAAH1
Plasmid#243679PurposeExpresses Medicago truncatula FAAH1 isoform in E. coli.DepositorInsertMedicago truncatula Fatty Acid Amide Hydrolase 1
Tagsc-myc, 6xHISExpressionBacterialPromotertrcAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTrcHIS2-MtFAAH2a
Plasmid#243680PurposeExpresses Medicago truncatula FAAH2a isoform in E. coli.DepositorInsertMedicago truncatula Fatty Acid Amide Hydrolase 2a
Tagsc-myc, 6xHISExpressionBacterialPromotertrcAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
LEP-shTADA1.1580
Plasmid#105568Purposeretrovirally express TADA1 shRNA with puro resistance and GFP markerDepositorInsertTADA1 shRNA
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC gRNA Shuttle
Plasmid#47024PurposeEncodes a template from which gRNAs can be made via InFusion cloning. The Medicago truncatula U6.6 promoter drives the gRNA. For use in plants.DepositorInsertgRNA Shuttle
UseCRISPR; Cas9ExpressionPlantMutationG to T cloning mutation at position 323PromoterMedicago truncatula U6.6Available SinceSept. 3, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
p CIneo-RL-Let7-3xBulgeB-mut
Plasmid#115369PurposeExpression vector to produce humanized Renilla luciferase with three mutated (seed-sequence mutations) partially complementary binding sites for human let-7 miRNA in the 3'UTRDepositorInsertRenilla Luciferase
UseLuciferaseExpressionMammalianPromoterCMVAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only