We narrowed to 27,982 results for: STI
-
Plasmid#179894PurposeDonor with homologous arms for Rab11a to knock in SFFV-T2A-Blasticidin resistance-PolyA cassette (for knock out)DepositorInsertRAB11A, member RAS oncogene family (RAB11A Human)
UseCRISPR; Donor for homologous based knock inExpressionBacterial and MammalianPromoterSFFVAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMY-CD90.2-P2A-BlastDYK
Plasmid#163349PurposeRetroviral vector to express the surface marker CD90.2 and a DYK-tagged blasticidin resistance markerDepositorAvailable SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
HA tagged SphI ELL2 M133, 138, 186ILeu
Plasmid#127277PurposeExpresses human ELL2 with M133, 138, 186ILeu to prevent internal Met initiation peptides and contains HA tag near C-terminusDepositorInsertELL2 with Met 133, 138, 186 to Ileu (ELL2 Human)
ExpressionMammalianMutationMet 133, 138, 186 to Ileu; HA inserted at SphI af…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
AiP11457 - pAAV-eHGT_078h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1457)
Plasmid#163495PurposeDirect-expressing SYFP2 AAV VirusDepositorInsertSYFP2
UseAAVPromoterminBetaGlobinAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP11244 - pAAV-hDLXI56i-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1244)
Plasmid#163493PurposeDirect-expressing SYFP2 AAV VirusDepositorInsertSYFP2
UseAAVPromoterminBetaGlobinAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP11253 - pAAV-eHGT_017h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1253)
Plasmid#163497PurposeDirect-expressing SYFP2 AAV VirusDepositorInsertSYFP2
UseAAVPromoterminBetaGlobinAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP12214 - pAAV-ProB12-SYFP2-WPRE3-BGHpA (Alias: CN2214)
Plasmid#208161PurposeAAV vector for SYFP2 expression in brain astrocytesDepositorInsertSYFP2
UseAAVMutationNAPromoterBeta Globin minimal promoterAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
AiP11466 - pAAV-eHGT_078m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1466)
Plasmid#163508PurposeDirect-expressing SYFP2 AAV VirusDepositorInsertSYFP2
UseAAVPromoterminBetaGlobinAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP11259 - pAAV-eHGT_023h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1259)
Plasmid#163499PurposeDirect-expressing SYFP2 AAV VirusDepositorInsertSYFP2
UseAAVPromoterminBetaGlobinAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP11258 - pAAV-eHGT_022h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1258)
Plasmid#163506PurposeDirect-expressing SYFP2 AAV VirusDepositorInsertSYFP2
UseAAVPromoterminBetaGlobinAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP1351 - pAAV-AiE2E122m-minBGpromoter-SYFP2-WPRE3-bGHpA
Plasmid#208139PurposeDirect-expressing SYFP2 in astrocytes AAV VirusDepositorInsertSYFP2
UseAAVMutationNAPromoterBeta Globin minimal promoterAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA blast
Plasmid#104993PurposeThis 3rd generation lentiviral plasmid expresses a S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from a U6 promoter and blasticidin S resistance from an EF-1a promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-UbC-Tet1v4-dCas9
Plasmid#232180PurposeTet1v4-dCas9 from Nuñez et al. 2021, in a lentiviral cassette with blasticidin resistance, for expression in mammalian cellsDepositorInsertTet1 catalytic domain - XTEN80 linker - dead Cas9 - 2A - BlastR (TET1 S. pyogenes, Human)
UseLentiviralTagsFLAGExpressionMammalianMutationD10A, H840APromoterhUbCAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPD292 PPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-BFP
Plasmid#249156PurposeOverexpression of PPH-T2A-dCas9-NFZ-P2A-BFP with HBB IVS2 intron in PPH coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertPPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-mTagBFP2 (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-EF1a-Cas9Bsd-W
Plasmid#68343PurposeLentiviral vector expressing Cas9 fused with the Blasticidin resistant gene at the C-terminusDepositorInsertEF1a-Cas9 cassette, WPRE
UseCRISPR and LentiviralTagsCas9 fused with Flag-tag and a NLS at the N termi…PromoterEF1aAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Click editor (CE1) mRNA expression vector - T7-5'UTR-PCV2-nCas9-EcKlenow-3'UTR-polyA (CJT472)
Plasmid#217808PurposeExpression vector for mRNA production of the click editor construct (CE1; PCV2-nCas9-EcKlenow)DepositorInsert5'UTR-PCV2-XTEN-nSpCas9-BPNLS-EcKlenow(exo-)-BPNLS-3'UTR
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterT7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
RMCE K>R DNA-PKcs
Plasmid#233917PurposeLow copy number provides expression of human DNA-PKcs with a single K>R substitution that ablates kinase activity.DepositorInserthuman DNA-PKcs kinase inactive mutant K3753>R (PRKDC Human)
ExpressionMammalianMutationK3753RAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-mCherry-G12V-KRAS-IRES-Blast
Plasmid#153336PurposeLentiviral vector plasmid for integration and constitutive expression of mCherry fused to oncogenic G12V-KRAS in mammalian cellsDepositorAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-EF1a-BsdCas9-W
Plasmid#67978PurposeLentiviral vector expressing Cas9 fused with the Blasticidin resistant gene at the N-terminusDepositorInsertEF1a-Cas9 cassette, WPRE
UseCRISPR and LentiviralTagsCas9 fused with Flag-tag and a NLS at the N termi…PromoterEF1aAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only