We narrowed to 12,197 results for: SHA;
-
Plasmid#89676PurposePlasmid for the construction of DNA-protein hybrid nanostructures. Template for the Drigalski spatula shown in figure 3E of associated article.DepositorInsertdrigalski
UseUnspecifiedAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pexK4_square
Plasmid#89674PurposePlasmid for the construction of DNA-protein hybrid nanostructures. Template for the square shown in figure 3F of associated article.DepositorInsertsquare
UseUnspecifiedAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pexK4_wm_ruleB
Plasmid#89675PurposePlasmid for the construction of DNA-protein hybrid nanostructures. Template for the three-armed star shown in figure 3D of associated article.DepositorInsertwm_ruleB
UseUnspecifiedAvailable SinceAug. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
LD123
Plasmid#69173PurposeIntegration of GFP tag at Atg23 C terminus, use auxotrophic marker URA3(Candida albicans)DepositorInsertAtg23-EGFP
TagsEGFPExpressionYeastAvailable SinceOct. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
LD114
Plasmid#69167PurposeIntegration of GFP tag at Atg14 C terminus, use auxotrophic marker URA3(Candida albicans)DepositorInsertAtg14-EGFP
TagsEGFPExpressionYeastAvailable SinceOct. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
LD105
Plasmid#69162PurposeIntegration of GFP tag at Atg5 C terminus, use auxotrophic marker URA3(Candida albicans)DepositorInsertAtg5-EGFP
TagsEGFPExpressionYeastAvailable SinceOct. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
LD131
Plasmid#69177PurposeIntegration of GFP tag at Atg31 C terminus, use auxotrophic marker URA3(Candida albicans)DepositorInsertAtg31-EGFP
TagsEGFPExpressionYeastAvailable SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
LD129
Plasmid#69176PurposeIntegration of GFP tag at Atg29 C terminus, use auxotrophic marker URA3(Candida albicans)DepositorInsertAtg29-EGFP
TagsEGFPExpressionYeastAvailable SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
LD124
Plasmid#69174PurposeIntegration of GFP tag at Atg24 C terminus, use auxotrophic marker URA3(Candida albicans)DepositorInsertAtg24-EGFP
TagsEGFPExpressionYeastAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
LD120
Plasmid#69171PurposeIntegration of GFP tag at Atg20 C terminus, use auxotrophic marker URA3(Candida albicans)DepositorInsertAtg20-EGFP
TagsEGFPExpressionYeastAvailable SinceSept. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
SIRT3 Flag
Plasmid#13814PurposeMammalian expression of human SIRT3 with flag tagDepositorAvailable SinceFeb. 19, 2007AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pREMORAv1
Plasmid#248172PurposepSC101-ts plasmid with salicylic acid inducible Lambda-RED operon and constituitive recA expressionDepositorInsertLambdaRED
ExpressionBacterialMutationNoneAvailable SinceFeb. 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
mTagBFP2-Lysosomes-20
Plasmid#55308PurposeLocalization: Lysosome Membrane, Excitation: 399, Emission: 456DepositorInsertLAMP1
TagsmTagBFP2ExpressionMammalianPromoterCMVAvailable SinceOct. 10, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
ER-mRFP
Plasmid#62236PurposePlasmid expresses endoplasmic reticulum targeted mRFP in mammalian cells.DepositorInsertER-mRFP
TagsmRFP1ExpressionMammalianPromotercmvAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCB1532S-RFP
Plasmid#101856PurposeGolden-Gate compatible fungal transformation vector carrying Sulfonylurea Resistance (Chlorimuron Ethyl) with RFP screening cassette (RFP knocked out by GG reaction, allowing for red-white screening)DepositorArticleTypeEmpty backboneUseFungal expression plasmid, tested in magnaportheAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT-TO-EGFP-UPF1-WT
Plasmid#136000PurposeDOX-inducible WT UPF1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex SystemDepositorInsertUPF1
TagsEGFPExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
SIRT6 Flag
Plasmid#13817PurposeMammalian expression of human SIRT6 with flag tagDepositorAvailable SinceFeb. 19, 2007AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1 puro
Plasmid#8452PurposeRetroviral vector for shRNA expression.DepositorTypeEmpty backboneUseRNAi and RetroviralExpressionMammalianAvailable SinceJune 20, 2005AvailabilityAcademic Institutions and Nonprofits only -
SIRT4 Flag
Plasmid#13815PurposeMammalian expression of human SIRT4 with flag tagDepositorAvailable SinceFeb. 19, 2007AvailabilityAcademic Institutions and Nonprofits only