We narrowed to 12,964 results for: BASE
-
Plasmid#123256PurposeMammalian expression plasmid for Env from the 001428 HIV-1 isolate; C-terminal truncation fused to the C-terminal half of split fluorescent Venus (VC)DepositorInsertHIV-1 (001428) Env
TagsCD5 leader peptide and VC (Venus residues D155–K2…ExpressionMammalianMutationCodon-optimized synthetic gene; C-terminal Env re…PromoterCMVAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-Q769-QES.i03.c04-754*
Plasmid#123228PurposeMammalian expression plasmid for Env from the Q769.d22 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (Q769.d22) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BaL-QES.i01.c08-754*
Plasmid#123213PurposeMammalian expression plasmid for Env from the BaL HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (BaL) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BG505.SOSIP-gp160-QES.i05.c06-754*
Plasmid#123275PurposeMammalian expression plasmid for Env from the BG505 HIV-1 isolate (containing SOSIP mutations); C-terminal truncation; QES mutant for enhanced presentation of quaternary epitopesDepositorInsertHIV-1 (BG505) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; SOSIP mutations; …PromoterCMVAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-DU422-QES.c12-754*
Plasmid#123249PurposeMammalian expression plasmid for Env from the DU422 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (DU422) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-Q842-QES.i04.c05-754*
Plasmid#123232PurposeMammalian expression plasmid for Env from the Q842.d12 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (Q842.d12) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-191084-QES.i06.c07-754*
Plasmid#123238PurposeMammalian expression plasmid for Env from the 191084 B7-19 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (191084 B7-19) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB026
Plasmid#119711PurposeTranscriptional Unit (TU) for YFP expression, obtained by combining FB/GBparts FB007+GB0053+FB008 into pDGB3alpha1R. According to FungalBraid/GoldenBraid modular DNA assembly for ATMTDepositorInsertPromoter gpdA:YFP coding sequence:Terminator trpC
UseSynthetic BiologyAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP319-pAAV-U6SaCas9gRNA(emx1sg2)-EFS-GFP-KASH-pA
Plasmid#113696PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP318-pAAV-U6SaCas9gRNA(emx1sg1)-EFS-GFP-KASH-pA
Plasmid#113695PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-P2A-Puro
Plasmid#110849PurposeLentiviral vector for constitutive expression of Cas9-VRER (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1-P2A-Puro
Plasmid#110850PurposeLentiviral vector for constitutive expression of Cas9-HF1 (not codon optimized)DepositorInsertCas9-HF1
UseLentiviralTags3X FLAGMutationN497A, R661A, Q695A, Q926APromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQR-PGK-Puro
Plasmid#110855PurposeLentiviral vector for constitutive expression of Cas9-VQR (not codon optimized)DepositorInsertCas9-VQR
UseLentiviralTags3X FLAGMutationD1135V, R1335Q, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-PGK-Puro
Plasmid#110856PurposeLentiviral vector for constitutive expression of Cas9-VRER (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET24a-VHH-1xTS
Plasmid#109418PurposeBacterial expression of a functionalized anti-GFP (VHH) nanobody fused to one tyrosine sulfation (TS) motif. VHH-1xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-GFP nanobody fused to a T7, TS, HA, BAP and His6 epitope
TagsBAP, HA, His6, T7, and Tyrosine sulfation (TS) se…ExpressionBacterialPromoterT7Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTKan-p35S::Csy4-pC4H::cogRFP (C90, JBEI-15908)
Plasmid#110143PurposeTransformation and expression of Csy4 and cogDsRed proteins in plantsDepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTKan-p35S::Csy4-pC4H::cogGFP (C44, JBEI-16338)
Plasmid#110144PurposeTransformation and expression of Csy4 and cogGFP proteins in plantsDepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
JG693: CAG-human dLbCpf1(D832A)-NLS-3xHA-3xFLAG-DmrA(X3)
Plasmid#104570PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to three DmrA domainsDepositorInsertdLbCpf1(D832A)-DmrA(x3)
Tags3x FLAG, 3x HA, and NLSExpressionMammalianMutationD832APromoterCAGAvailable SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
FN(9-10, RGE)-I27-CC
Plasmid#85396PurposeMTFM mechanosensor for integrin. Fibronectin domains 9&10 with RGE mutation fused to titan I27 domain with two cysteines for immobilization, site for p-azidophenylalanine incorporation & Cy3 labelingDepositorInsertFibronectin (FN) domains 9&10 containing RGE mutation fused to titin immunoglobulin domain (I27), containing a TAG (amber) codon
Tags6x HisExpressionBacterialMutationGRGDS motif mutated to GRGESPromoterT7Available SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_2] (GB1209)
Plasmid#75410PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)DepositorInserttRNA-gRNA position [M1_2]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUAST-HA, Pbl-A C-Term
Plasmid#69795PurposePebble isoform A, C-Term, in P element-based pUAST vector for Gal4-regulated expression in Drosophila.DepositorInsertPebble C-Term domain (Drosophila guanine nucleotide exchange factor)
UseP element-based puast vector for gal4-regulated e…TagsHA-TagExpressionInsectMutationJust the C-Term domain of Pebble (pbl)Promoterhsp70 promoterAvailable SinceOct. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C820S (NT573)
Plasmid#49075PurposeExpresses human NKCC1 C820S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutationC820S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C1052S (NT674)
Plasmid#49076PurposeExpresses human NKCC1 C1052S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutationC1052S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C791S (NT572)
Plasmid#49074PurposeExpresses human NKCC1 C791S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutationC791S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 intracellular-cysteineless (NT855)
Plasmid#49080PurposeExpresses human NKCC1 mutant lacking cysteine residues within intracellular loops and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutationC791S, C820S, C1052S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 ECL4 deletion (NT865)
Plasmid#49070PurposeExpresses human NKCC1 truncation mutant lacking extracellular loop #4 (aa562-582) and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutationECL4 deletion of amino acids 562-582 in hNKCC1 in…PromoterCMVAvailable SinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C543M (NT360)
Plasmid#49068PurposeExpresses human NKCC1 C543M mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutationC543M in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C723S,C724V (NT501)
Plasmid#49073PurposeExpresses human NKCC1 C723S and C724V mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutationC723S,C724V in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C630S (NT400)
Plasmid#49072PurposeExpresses human NKCC1 C630S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutationC630S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C630A (NT399)
Plasmid#49071PurposeExpresses human NKCC1 C630A mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutationC630A in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 cysteineless (NT868)
Plasmid#49079PurposeExpresses human NKCC1 mutant lacking cysteine residues and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutationC295A, C543M, C563S,C568S,C577S,C582S, C630S, C72…PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 TM-cysteineless (NT859)
Plasmid#49078PurposeExpresses human NKCC1 mutant lacking cysteine residues within transmembrane domains and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic,containing convenient restriction sitesDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutationC295A, C543M, C630S, C723S, C724V in hNKCC1 in NT…PromoterCMVAvailable SinceNov. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C295A (NT104)
Plasmid#49067PurposeExpresses human NKCC1 C295A mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutationC295A in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 1, 2013AvailabilityAcademic Institutions and Nonprofits only