We narrowed to 10,182 results for: yeast
-
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
416Gal-FUS-R514S-YFP
Plasmid#29617DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
416Gal-FUS-R524S-YFP
Plasmid#29626DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
416Gal-FUS-R522G-YFP
Plasmid#29625DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
3405 pBM272 Bid p22
Plasmid#8771DepositorInsertBid p22 (Bid Mouse)
ExpressionYeastAvailable SinceJuly 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
pCMV_SS-HA-V5-LacAnc100-CD4 TM_pDisplay
Plasmid#245299Purposeexpresses LaccID on the mammalian cell surfaceDepositorInsertLacAnc100-CD4TM
ExpressionYeastAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
yTREX-ApR
Plasmid#177307Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5DepositorTypeEmpty backboneUseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW21K_1Ti1
Plasmid#177291Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcR and eYFPDepositorInserteYFP
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW27K_7Ti1
Plasmid#177294Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon/SacB with TcR and LacZDepositorInsertPsacB-sacB
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTSK56K_3G7
Plasmid#177301Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn7 with GmR and mCherryDepositorInsertmCherry
UseSynthetic Biology; Yeast expression, tn7 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTSK58K_6G7
Plasmid#177302Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn7 with GmR and PE-HDepositorInsertpe-h
UseSynthetic Biology; Yeast expression, tn7 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTSK65K_8G7
Plasmid#177303Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn7 with GmR and GUSDepositorInsertuidA
UseSynthetic Biology; Yeast expression, tn7 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW07K_0G5
Plasmid#177279Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmRDepositorInsertPaacC1-aacC1
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW08K_0C5
Plasmid#177280Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with CmRDepositorInsertPcat-cat
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW11K_0S5
Plasmid#177282Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with SmRDepositorInsertPaadA-aadA
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW14K_7G5
Plasmid#177283Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and LacZDepositorInsertlacZ
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW15K_2G5
Plasmid#177284Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and mTagBFP2DepositorInsertmTagBFP2
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW17K_6G5
Plasmid#177285Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and PE-HDepositorInsertpe-h
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW16K_1G5
Plasmid#177286Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and eYFPDepositorInserteYFP
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW13K_3G5
Plasmid#177287Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and mCherryDepositorInsertmCherry
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW18K_3T5
Plasmid#177288Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with TcR and mCherryDepositorInsertmCherry
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW20K_0Ti1
Plasmid#177289Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcRDepositorInsertPtet-tetA(C)
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW28K_0Ti1
Plasmid#177290Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon/SacB with TcRDepositorInsertPsacB-sacB
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC-His+Strep-Opa1 (SB254)
Plasmid#227603PurposeInducible coexpression of His-tagged SLC25A46 and Strep-tagged Opa1 in Pichia pastorisDepositorInsertsTags10xHis and Twin-StrepTagExpressionYeastMutationcontains aa 253-960 onlyPromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC25A46[∆2-83]-His (SB258)
Plasmid#227607PurposeInducible expression of His-tagged SLC25A46 lacking its N-terminal region (∆2-83) in Pichia pastorisDepositorInsertSLC25A46 (SLC25A46 Human)
Tags10xHisExpressionYeastMutationaa 2-83 deletedPromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-Strep-Opa1(MGD) (SB252)
Plasmid#227601PurposeInducible expression of Strep-tagged Opa1(MGD) in Pichia pastorisDepositorInsertOPA1 (OPA1 Human)
TagsTwin-StrepTagExpressionYeastMutationcontains aa 253-580 (MGD) and aa 938-960PromoterAOX1Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-GAL4-PARP1-CAT-L713F
Plasmid#175949PurposeBacterial expression of a fusion of yeast GAL4 DNA binding domain and human PARP1 CAT domain containing L713F gain-of-function mutationDepositorInsertGAL4 DNA binding domain (GAL4 Budding Yeast)
Tags6xHis tagExpressionBacterialMutationL713F, V762A for the 'PARP1-CAT-L713F' …PromoterT7Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pILGFPEasy9R
Plasmid#218291PurposePlasmid-free in-situ promoter cloning and characterisation system in S. cerevisiae, allows the characterisation of a bidirectional promoter using yEGFP and E2-Crimson as reporters.DepositorInsertpURA3>KlURA3>tKlURA3-tPGK1KanMX>tAgTEF-pMAL32>MazF(RPL28i)-E2Crimson>tPDC1-pDDI2>ISceI>tSynth3>ura3(4,191)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp21R
Plasmid#218287PurposeA complete plasmid for ToxAmp (Toxin-antitoxin-driven gene amplification) for the expression of AeBlueDepositorInsertHO(-955, -789)-LoxP>pKlLEU2>KlLEU2>PCRT1>RelB>tPDC1-pTDH3>AeBlue>tSYNth7-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp12
Plasmid#218286PurposeMulti-copy integration of heterologous genes (AeBlue and RelB) through co-transformation with ToxAmp (toxin-antitoxin-driven gene amplification) modulesDepositorInsertHO(-253, -1)-pCRT1>RelB>tPDC1-pTDH3>AeBlue>tsynth7-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp1
Plasmid#218285PurposeAmplifying the gene copy number of heterologous genes (yEGFP and RelB) through ToxAmp (toxin-antitoxin-driven gene amplification) mechanismDepositorInsertHO(-253, -1)-pRPL8B>RelB>tPDC1-pTEF1>yEGFP>tURA3-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxamEXP4CUP1
Plasmid#218284PurposeUse together with pJE13HD7 and pJE13HD7 derivatives to integrate RelE expression cassette under the control of the CUP1 promoter at ho locusDepositorInsertHph>tAgTEF1-ISceI-Repeat2-pCUP1>RelE(1-125)>RPL28intron>RelE(126, 289)>tTPI1-HO(1828, 1979)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4QE2Crimson
Plasmid#218280PurposeIntroduction of a bicistronic expression cassette of yEGFP and E2Crimson under the control of the SkGAL2 promoterDepositorInsertpURA3>KlURA3>tKlURA3-pSkGAL2>yEGFP>ERBV1.2A>E2Crimson>tURA3
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRGAL4A
Plasmid#218277PurposeIntroduction of a LowTempGAL Turbo module (GAL4) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pNRG2>GAL4>tNRG2-fcy1(454-778)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSC5-toxic3
Plasmid#188625PurposepSC5GGv2 with HindII Gene InsertDepositorInsertHindII
UseSynthetic Biology; Diatom expressionExpressionBacterial and YeastMutationACT1 intron insertAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins1
Plasmid#195038PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tDEG1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed VLP NES (M)
Plasmid#182435PurposeYIp for expressing Murine polyomavirus deltaVP1 (GAL1 promoter), VP2C-ERG20(F96W-N127W) (GAL10 promoter), and VP2C-AcNES1 (GAL7 promoter). Contains uracil marker (K. lactis URA3).DepositorInsertsVP2C-FPPS(M)
deltaVP1
VP2C-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1, GAL10, and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed VLP NES (G)
Plasmid#182477PurposeYIp for expressing Murine polyomavirus deltaVP1 (GAL1 promoter), VP2C-ERG20(F96C) (GAL10 promoter), and VP2C-AcNES1 (GAL7 promoter). Contains uracil marker (K. lactis URA3).DepositorInsertsVP2C-FPPS(G)
deltaVP1
VP2C-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1, GAL10, and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only