We narrowed to 40,317 results for: kan
-
Plasmid#101839Purposedeletes zwf_fbp_opcA locusDepositorInsertKanamycin casette (in place of synpcc7942_2333-2335 operon)
UseCloning vectorAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
p201N 1510a.2
Plasmid#55770PurposeContains soybean miRNA miR1510a.2 recognition sequence (ATGGGTGGAATAGGGAAAACAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceOct. 23, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 5770
Plasmid#55772PurposeContains soybean miRNA miR5770 recognition sequence (TCTTGTCCAAACCATAGTCCAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 1510
Plasmid#55771PurposeContains soybean miRNA miR1510 recognition sequence (AGGTGGAATAGGAAAAACAACT) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 3514
Plasmid#55769PurposeContains soybean miRNA miR3514 recognition sequence (AAGGTCTCTGTCTTAATGGTGA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceAug. 21, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKS100
Plasmid#24630DepositorInsertfadD
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 11, 2010AvailabilityAcademic Institutions and Nonprofits only -
pJMP3654
Plasmid#222349PurposeExpression vector with GFP expressed under PabstBR promoter, kanR marker, and replicates in A. baumannii and E. coli.DepositorInsertsfGFP
ExpressionBacterialPromoterPabstBRAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
B-gTEMP/pRSET-b
Plasmid#188446PurposeB-gTEMP for bacterial expressionDepositorInsertB-gTEMP
Tags6xHis-tagExpressionBacterialAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL0_5 [pAL5000 ORI]
Plasmid#198922PurposeLevel 0 partDepositorInsertpAL5000 ORI
UseSynthetic BiologyAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFS554
Plasmid#242854PurposeThis plasmid will be used to replace the promoter of a gene with the PenotetSW3 promoter at its endogenous locusDepositorInsertsTetR
mECitrine
ExpressionYeastPromoterCMV promoter and enotetSW3 promoterAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFS553
Plasmid#242853PurposeThis plasmid will be used to replace the promoter of a gene with the PenotetSW2 promoter at its endogenous locusDepositorInsertsTetR
mECitrine
ExpressionYeastPromoterCMV promoter and enotetSW2 promoterAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFS552
Plasmid#242852PurposeThis plasmid will be used to replace the promoter of a gene with the PenotetSW1 promoter at its endogenous locusDepositorInsertsTetR
mECitrine
ExpressionYeastPromoterCMV promoter and enotetSW1 promoterAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL0_12 [pAMβ1 ORI]
Plasmid#198926PurposeLevel 0 partDepositorInsertpAMβ1 ORI
UseSynthetic BiologyAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDD120
Plasmid#119879PurposeConstitutive expression of Che9c60 and Che9c61 recombinases on pB264/pBR322 backbone with kanamycin resistance.DepositorInsertpConstitutive_Che9c60 and Che9c61
ExpressionBacterialAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICH-roGFP2-synORP1
Plasmid#191680PurposeTi plasmid pICH86988 harbouring roGFP2-synORP1 for H2O2 detection in plant cells.DepositorInsertrredox(roGFP2-synORP1
ExpressionPlantPromoterCaMV 35SAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDD57
Plasmid#119882PurposeConstitutive expression of GFP+ on pAL5000/pMB1 backbone with kanamycin resistance.DepositorInsertpConstitutive_GFP+
ExpressionBacterialAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDB4581
Plasmid#171124PurposeA kanMX-marked pFA6a based plasmid, which has a 7-aa linker, a 16-aa XTEN16 linker, three tandam repeats of sAID. It serves as the template for 3_sAID degron tagging at the C-terminus.DepositorInsert3_sAID
UseOtherMutationnon applicableAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMVTO-nTVMVP-AP4-tevs-P3-tevs-cTVMVPmut
Plasmid#179660PurposeCytosolic TEVP-inducible caged-nTVMVPDepositorInsertCaged-nTVMVP
ExpressionMammalianAvailable SinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMVTO-nTVMVPmut-tevs-AP4-tevs-P3-cTVMVP
Plasmid#179661PurposeCytosolic TEVP-inducible caged-cTVMVPDepositorInsertCaged-cTVMVP
ExpressionMammalianAvailable SinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-GFP1-10-IRES-Puro
Plasmid#211467PurposeLentivirus backbone expressing GFP1-10DepositorInsertGFP1-10
UseLentiviralExpressionMammalianPromoterEF-1aAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only