We narrowed to 2,122 results for: Rp1
-
Plasmid#163759PurposeGal-inducible yeast expression of the mitochondrial "clogger" protein b2(167)-DHFRDepositorInsertb2-DHFR (Dhfr Budding Yeast, Mouse)
ExpressionYeastMutationAmino acids 1-167 of S.c. Cytochrome b2 (Cyb2) fu…PromoterGAL1Available SinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ZFAND3_DGKH
Plasmid#205959PurposeExpress mEGFP-tagged fusion protein, ZFAND3_DGKH from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
FERMT1_pLX307
Plasmid#98333PurposeLentiviral expression of FERMT1DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
TFORF2594
Plasmid#144048PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-NR4A1-P2A-mCherry
Plasmid#203859PurposeTet-inducible lentiviral plasmid expressing NR4A1-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertNR4A1 (NR4A1 Human)
ExpressionMammalianAvailable SinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
LRPPRC gRNA (BRDN0001145987)
Plasmid#77773Purpose3rd generation lentiviral gRNA plasmid targeting human LRPPRCDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GIV-F1685A FLAG
Plasmid#65948PurposeExpression GIV/Girdin F1685A mutation in Mammalian cellDepositorInsertGIV/Girdin (CCDC88A Human)
Tags3xFlagExpressionMammalianMutationPhenylalanine 1685 to AlaninePromoterCMVAvailable SinceJan. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
LRPPRC gRNA (BRDN0001147349)
Plasmid#77774Purpose3rd generation lentiviral gRNA plasmid targeting human LRPPRCDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC25A44_STOP
Plasmid#161208PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC25A44 (SLC25A44 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits