We narrowed to 10,182 results for: yeast
-
Plasmid#176550PurposeExpression of mRuby2 for auxotrophic selection in the absence of methionineDepositorInsertyomRuby2
ExpressionYeastPromoterTDH1(GAP)Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pL-mWasabi
Plasmid#176552PurposeExpression of mWasabi for auxotrophic selection in the absence of leucineDepositorInsertmWasabi
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pM-eCFP
Plasmid#176558PurposeExpression of eCFP for auxotrophic selection in the absence of methionineDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pH-TagRFP657
Plasmid#176560PurposeExpression of TagRFP657 for auxotrophic selection in the absence of lysineDepositorInsertTagRFP657
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
YCplac33-NAT_MCART1K91A
Plasmid#140592PurposeExpress MCART1K91A in S. cerevisiaeDepositorInsertSLC25A51 with 5' and 3' UTR of scNDT1 (SLC25A51 Human)
ExpressionYeastMutationcodon-optimized for expression in S. cerevisiae; …PromoterNDT1 promoter and 3'UTRAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMS22H-IRE
Plasmid#133905PurposePositive control when used in combination with pAWH-IRP. Expression of MS2BS-IRE site hybrid. Homology regions for recombination with pAWHDepositorAvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar4.3
Plasmid#232743PurposeExpresses NADPH/NADP+ biosensor NAPstar4.3 in S. cerevisiae.DepositorInsertNAPstar4.3
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstarC
Plasmid#232737PurposeExpresses control sensor NAPstarC in S. cerevisiae.DepositorInsertNAPstarC
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar3
Plasmid#232740PurposeExpresses NADPH/NADP+ biosensor NAPstar3 in S. cerevisiae.DepositorInsertNAPstar3
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Ndi-1/myc-His
Plasmid#127503PurposeExpresses myc-tagged yeast Ndi-1 in mammalian cellsDepositorAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar1
Plasmid#232738PurposeExpresses NADPH/NADP+ biosensor NAPstar1 in S. cerevisiae.DepositorInsertNAPstar1
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
DENV4 Rluc Reporter GND mutant Replicon
Plasmid#118586PurposeFor use as a positive control for translation of the Rluc gene in the transfected cells and negative control for replication.DepositorInsertDENV4 Renilla luciferase gene (Rluc) reporter replicon containing replication-defective GND mutation in the NS5 polymerase gene.
UseYeast-e. col shuttle vector prs424MutationThe conserved GDD in the NS5 polymerase gene muta…Available SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAG416GALL-HIV-1_PR
Plasmid#203493PurposeExpresses HIV-1 protease from a GALL promoter with a URA3 markerDepositorInsertHIV-1 protease
ExpressionYeastPromoterGALLAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAGE2.0
Plasmid#165984PurposeMulti-host shuttle vector that can be transferred by conjugation and replicate in S. meliloti, E. coli, S. cerevisiae, and P. tricornutum. Contains S. meliloti pSymA origin and Tet resistance.DepositorInsertsRK2/RP4 origin of transfer
repA2B2C2
nourseothricin N-acetyl transferase
tetracycline resistance
UseSynthetic Biology; Bacterial and yeast cloning; c…Available SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBKWH-Lam
Plasmid#133899PurposeNegative control. Expression of Gal4BD-Lam hybrid protein. Homology regions for recombination with pAWHDepositorAvailable SinceJune 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:mTREK-1_cryst
Plasmid#133269PurposeP. pastoris expression vector. It will generate the mouse TREK-1 channel (21-322) fused to a C-terminal GFPDepositorInsertPotassium channel subfamily K member 2 (KCNK2, TREK-1) (Kcnk2 Mouse)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationaa 21-322, K84R, Q85E, T86K, I88L, A89R, Q90A, A9…Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCHKU34.1-2.2
Plasmid#115534PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertPKS
ExpressionYeastAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYO391
Plasmid#235751PurposeProtein expression of ScVPS38, untagged + ScVPS34, untagged + FL ScVPS15-ZZ + ZZ-FL ScVPS30DepositorInsertsTags3xTEV-ZZ and ZZ-3xTEVExpressionYeastMutationS2A and T134A, I851RPromoterGALGAPDHAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar2
Plasmid#232739PurposeExpresses NADPH/NADP+ biosensor NAPstar2 in S. cerevisiae.DepositorInsertNAPstar2
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar4
Plasmid#232741PurposeExpresses NADPH/NADP+ biosensor NAPstar4 in S. cerevisiae.DepositorInsertNAPstar4
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar6
Plasmid#232742PurposeExpresses NADPH/NADP+ biosensor NAPstar6 in S. cerevisiae.DepositorInsertNAPstar6
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar7
Plasmid#232744PurposeExpresses NADPH/NADP+ biosensor NAPstar7 in S. cerevisiae.DepositorInsertNAPstar7
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC-His+MFN2-Strep (SB255)
Plasmid#227604PurposeInducible coexpression of His-tagged SLC25A46 and Strep-tagged MFN2 in Pichia pastorisDepositorTags10xHis and Twin-StrepTagExpressionYeastPromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRHD-TetR-GAL80-Rho1-GAL4
Plasmid#218274PurposeIntroduction of low-temperature-inducible GAL system, LowTempGAL v2.2DepositorInsertgal80Arm1-pAgTEF1>KanMX4>tAgTEF1-pHAC1>UBI4>>DHFRP66L-TetR>NLS>TUP1>tABF1-pTEF2>Rho1C17R>>GAL4>tGAL4-pTEF1(TetO)>GAL80Arm2
ExpressionYeastMutationDHFR (P66L), Rho1 (C17R)Available SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRHDGAL43C
Plasmid#218279PurposeIntroduction of a LowTempGAL Turbo module (HD-GAL43C) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pNRG2>GAL4>tNRG2-PENO2> UBI4>RHGSGTMV>DHFRP66L>G*6>GAL3C(S509P)-tENO2-fcy1(454-778)
ExpressionYeastMutationGAL3 (S509P), DHFR (P66L)Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRGAL43C
Plasmid#218278PurposeIntroduction of a LowTempGAL Turbo module (GAL43C) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pNRG2>GAL4>tNRG2-pENO2>GAL3C(S509P)>tENO2-fcy1(454-778)
ExpressionYeastMutationGAL3 (S509P)Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRHDGAL3C
Plasmid#218276PurposeIntroduction of a LowTempGAL Turbo module (HD-GAL3C) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pENO2> UBI4>RHGSGTMV>DHFRP66L>G*6>GAL3C(S509P)>tENO2-fcy1(454-778)
ExpressionYeastMutationGAL3 (S509P), DHFR (P66L)Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRGAL3C
Plasmid#218275PurposeIntroduction of a LowTempGAL Turbo module (GAL3C) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pENO2>GAL3C(S509P)>tENO2-fcy1(454-778)
ExpressionYeastMutationGAL3 (S509P)Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pADH2-crtE-tNOS-pXYL-crtI-tNOS-pGPD-crtYB-tNOS+ku70 insD (SBE146)
Plasmid#195048Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pADH2-crtE-tNOS-pGPD-crtI-tNOS-pXYL-crtYB-tNOS+ku70 insD (SBE145)
Plasmid#195047Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pXYL-crtE-tNOS-pGPD-crtI-tNOS-pADH2-crtYB-tNOS+ku70 insD (SBE144)
Plasmid#195046Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-LV_3CL
Plasmid#203507PurposeExpresses LV 3CL protease from a GAL promoter with a URA3 markerDepositorInsertLV 3CL protease
ExpressionYeastPromoterGAL1Available SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-HTLV_PR
Plasmid#203467PurposeExpresses HTLV protease from a GAL10 promoter with a URA3 markerDepositorInsertHTLV protease
ExpressionYeastPromoterGAL10Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-EYFP
Plasmid#201792PurposeExpresses EYFP from a GAL promoter with a URA3 markerDepositorInsertEYFP
ExpressionYeastPromoterGAL1Available SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBGE2.0
Plasmid#165987PurposeMulti-host shuttle vector that can be transferred by conjugation and replicate in S. meliloti, E. coli, S. cerevisiae, and P. tricornutum. Contains S. meliloti pSymB origin and Tet resistance.DepositorInsertsRK2/RP4 origin of transfer
repA1B1C1
nourseothricin N-acetyl transferase
tetracycline resistance
UseSynthetic Biology; Bacterial and yeast cloning; c…Available SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-His6-K2P4.1A-mCherry-StreptagII
Plasmid#158743PurposeExpresses K2P4.1 isoform A with TEV protease cleavable N- and C-terminal affinity tags.DepositorInsertK2P4.1-A (KCNK4 Human)
TagsHis6 and mCherry with Streptag IIExpressionYeastMutationResidues 1-264 with N-linked glycosylation sites …PromoterAOX1Available SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-His6-K2P4.1B-mCherry-StreptagII
Plasmid#158744PurposeExpresses K2P4.1 isoform B with TEV protease cleavable N- and C-terminal affinity tags.DepositorInsertK2P4.1-B (KCNK4 Human)
TagsHis6 and mCherry with Streptag IIExpressionYeastMutationResidues 1-290 and N-linked glycosylation sites r…PromoterAOX1Available SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCHTV86.1-2.2
Plasmid#115544PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertS_cerevisiae_ADH2-ORF1, S_bayanus_ADH2-ORF2, PCK1-ORF3
ExpressionYeastAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCHSU64.1-2.2
Plasmid#115542PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertPKS
ExpressionYeastAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCHKU38.1-2.2
Plasmid#115540PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertPKS
ExpressionYeastAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCHKU37.2-2.2
Plasmid#115539PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertS_cerevisiae_ADH2-ORF1, S_bayanus_ADH2-ORF2, PCK1-ORF3, MLS1-ORF4
ExpressionYeastAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only