We narrowed to 157 results for: SHH
-
Plasmid#37677DepositorInsertshh (Shh Mouse)
Tagsrenilla luciferaseExpressionMammalianMutationsoluble form (see comments)PromoterCMVAvailable SinceNov. 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EGFR-Y764_V765insHH
Plasmid#116319PurposeLentiviral expression of EGFR Y764_V765insHHDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR CDS
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR 3UTR
Plasmid#110412PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
RCAS (A) shh (CT#251)
Plasmid#13991DepositorInsertshh (SHH Chicken)
UseRetroviral; Avian expressionAvailable SinceFeb. 9, 2007AvailabilityAcademic Institutions and Nonprofits only -
RCAS (E) shh (CT#489)
Plasmid#13992DepositorInsertshh (SHH Chicken)
UseRetroviral; Avian expressionAvailable SinceFeb. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-SRSF2-P95_R102delPPDSHHSR
Plasmid#116684PurposeLentiviral expression of SRSF2 P95_R102delPPDSHHSRDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHTSHP-Smt-IIShhN
Plasmid#121135PurposeExpresses N-terminal SUMO tagged II-ShhN in bacteriaDepositorInsertShh (Shh Mouse)
TagsHIS, HRV3C site, MBP, and Smt tagExpressionBacterialMutationAmino acid sequence from 26-195, with two extra i…PromotertacAvailable SinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PM mir shHoxB9 b
Plasmid#27020DepositorInsertmir HoxB9 3b
UseRNAi and RetroviralExpressionMammalianAvailable SinceJan. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-shHsp90ab1(#c)
Plasmid#206359PurposeAAV plasmid expressing HSP90AB1 shRNA in photoreceptorsDepositorInsertshRNA of Hsp90ab1 (#c)
UseAAVPromoterhuman red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-shHsp90ab1 (#a)
Plasmid#206357PurposeAAV plasmid expressing HSP90AB1 shRNA in photoreceptorsDepositorInsertshRNA #a of Hsp90ab1
UseAAVPromoterhuman red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHTSHP-ShhN-Cys
Plasmid#121136PurposeExpresses ShhN with a C-terminal cysteine residues in bacteriaDepositorInsertshh (Shh Mouse)
TagsHIS, HRV3C site, and MBPExpressionBacterialMutationAmino acid sequence from 26-191, with an addition…PromotertacAvailable SinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PM mir shHoxB9 a
Plasmid#27021DepositorInsertmir HoxB9 2A
UseRNAi and RetroviralExpressionMammalianAvailable SinceJan. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDonor14-ShHELIX-KanR (CJT70)
Plasmid#181793PurposepDonor for ShHELIX containing 14bp of spacing between the I-AniI site and LE/RE and encoding a kanamycin resistance gene as cargoDepositorInsertKanR, R6K origin of replication
ExpressionBacterialAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
PCR4-Shh::lacZ-H11
Plasmid#139098PurposeenSERT LacZ reporter vector for site-specific integration into the H11 locus (contains Shh minimal promoter)DepositorTypeEmpty backboneUseCRISPR and Mouse TargetingExpressionMammalianPromoterShhAvailable SinceMarch 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCCLc-U6-shHMGA2.3-PGK-dTomato
Plasmid#89606PurposeSilencing Hmga2 in human cellsDepositorAvailable SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCCLc-U6-shHMGA2.2-PGK-dTomato
Plasmid#89605PurposeSilencing Hmga2 in human cellsDepositorAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET19b-rShHTL7 cPGFP(E167)
Plasmid#166004PurposeExpression of coding sequence in Escherichia coliDepositorInsertrShHTL7 cPGFP(E167)
ExpressionBacterialPromoterT7 promoterAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET19b-rShHTL7 cPGFP(D165)
Plasmid#166003PurposeExpression of coding sequence in Escherichia coliDepositorInsertrShHTL7 cPGFP(D165)
ExpressionBacterialPromoterT7 promoterAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only