We narrowed to 7,667 results for: trac
-
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EREG-ScNeo
Plasmid#209896PurposeTo monitor the status of Epiregulin, the plasmid encodes a recombinant Epiregulin fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertEREG-ScNeo (EREG Human)
UseLentiviralTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…Available SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EPGN-ScNeo
Plasmid#209899PurposeTo monitor the status of Epigen, the plasmid encodes a recombinant Epigen fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL 5N>Q
Plasmid#202419PurposeExpression of GFP-tagged PODXL with mutated N-linked glycosylation sitesDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSH1/M-FGFR1-Fv-Fvls-E
Plasmid#15285DepositorInsertFGFR1 kinase, FKBP12v36 (Fgfr1 Mouse)
TagsHA epitope and Myristoylation-targeting domain c-…ExpressionMammalianMutationFGFR1 cytoplasmic domain FKBP12 F36VAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
ATX3-13Q
Plasmid#184248PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track (ATXN3 Synthetic, Human)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationC-terminal codon optimization for protein expres…PromoterT7 promoterAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H326
Plasmid#228242PurposemT2Del_EPACdDEPCD_Q270E_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H327
Plasmid#228243PurposemT2Del_EPACdDEPCD_Q270E_M312L_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_M312L_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H328
Plasmid#228244PurposemT2Del_EPACdDEPCD_Q270E_M312L_E325T_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_M312L_E325T_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H329
Plasmid#228245PurposemT2Del_EPACdDEPCD_Q270E_E325T_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_E325T_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EGF-ScNeo
Plasmid#209893PurposeTo monitor the status of EGF, the plasmid encodes a recombinant EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-HBEGF-ScNeo
Plasmid#209894PurposeTo monitor the status of HB-EGF, the plasmid encodes a recombinant HB-EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-Dlx-SynaptoTAG
Plasmid#210729PurposeAAV vector for mapping synaptic projections. GABAergic neuron-specific Dlx promoter expresses EGFP-Synaptobrevin-2 to label synaptic terminals and Palm-tdTomato to label neuronal soma and axons.DepositorInsertEGFP-Synaptobrevin-2, P2A, Palm-tdTomato (tdTomato with Palmitoylation sequence) (Vamp2 Synthetic, Rat)
UseAAVPromoterDlxAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbleo-EREG-ScNeo
Plasmid#209905PurposeTo monitor the status of Epiregulin, the plasmid encodes a recombinant Epiregulin fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertEREG-ScNeo (EREG Human)
TagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRY2high-mCherry-Raf1
Plasmid#104064PurposeExpresses fusion of CRY2high mutant (CRY2PHR E490R) with mCherry and Raf1DepositorExpressionMammalianMutationCRY2PHR E490RPromoterCMVAvailable SinceDec. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin P1
Plasmid#68816PurposeFlag tagged Geph mammalian expressionDepositorInsertGephyrin (Gphn Rat)
Tags3xFLAGExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyrin…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHOT-P2Y2R
Plasmid#159108Purposeentiviral vector encoding P2Y purinoceptor 2 (P2Y2R), a high affinity G-protein coupled receptor that mobilizes Ca2+ from intracellular stores upon binding extracellular ATP.48,49 By using the GibsonDepositorInsertP2Y2R
UseLentiviralPromoterUBCAvailable SinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
mini-YFP-hDF-C2F-TM
Plasmid#72600Purposemini human dysferlin (from domain F to transmembrane ) tagged with YFPDepositorInsertdysferlin (DYSF Human)
TagsEYFPExpressionMammalianMutationfrom domain F to transmembrane domainPromoterCMVAvailable SinceApril 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
FRIG-myc-Sema4D-CD4
Plasmid#51606Purposeexpresses myc-tagged Sema4D/CD4 non-cleavable chimera with extracellular Sema4D, intracellular CD4 in lentiviral backboneDepositorInsertSema4D/CD4-FLAG (Sema4d Mouse, Human)
UseLentiviralTagsFLAG and mycExpressionMammalianMutationSema4D amino acids 660-861 were replaced with CD4…PromoterRSVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only