We narrowed to 12,882 results for: LIC
-
Plasmid#186880PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with N-terminal GFP fusion (Adamts1 Human, Synthetic)
UseRetroviralTagsGFPExpressionMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN-OMM
Plasmid#186881PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with C-terminal MAVS transmembrane domain (503-541 a.a.) fusion (Adamts1 Human, Synthetic)
UseRetroviralTagsExpressionMutationN-terminal truncation, MAVS transmembrane domain …PromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN-Pex
Plasmid#186882PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with C-terminal PEX13 transmembrane domain (136-233 a.a.) fusion (Adamts1 Human, Synthetic)
UseRetroviralTagsExpressionMutationN-terminal truncation, PEX13 transmembrane domain…PromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN-ER
Plasmid#186883PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with C-terminal VAMP2 transmembrane domain (86-119 a.a.) fusion (Adamts1 Human, Synthetic)
UseRetroviralTagsExpressionMutationN-terminal truncation, VAMP2 transmembrane domain…PromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-FLAG-human cGAS N-T2A-deltaN-HA
Plasmid#186886PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS with T2A ribosome skipping sequences between N-terminus (1-159 a.a.) and C-terminus (160-522 a.a.) (Adamts1 Human)
UseRetroviralTagsFLAG and HAExpressionMutationInsertion of T2A ribosome skipping sitePromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-human cGASdeltaN-OMM
Plasmid#186887PurposeExpression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with C-terminal MAVS transmembrane domain fusion (Adamts1 Human, Synthetic)
UseLentiviralTagsExpressionMutationN-terminal truncation, MAVS transmembrane domain …PromoterCMVAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-orangutan cGASdeltaN-OMM
Plasmid#186888PurposeExpression of orangutan cGAS gene in mammalian cells by retroviral transductionDepositorInsertOrangutan cGAS truncation mutant (158-521 a.a.) with C-terminal MAVS transmembrane domain fusion (CGAS Pongo abelii, Synthetic)
UseLentiviralTagsExpressionMutationN-terminal truncation, MAVS transmembrane domain …PromoterCMVAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGAS:156-522aa-HA
Plasmid#186856PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (156-522 a.a.) with C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAExpressionMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGAS:158-522aa-HA
Plasmid#186857PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (158-522 a.a.) with C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAExpressionMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGAS:162-522aa-HA
Plasmid#186858PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (162-522 a.a.) with C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAExpressionMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGAS:164-522aa-HA
Plasmid#186859PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (164-522 a.a.) with C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAExpressionMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGAS:166-522aa-HA
Plasmid#186860PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (166-522 a.a.) with C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAExpressionMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-crab-eating macaque cGASdeltaN-HA
Plasmid#186870PurposeDoxycycline-dependent expression of crab-eating macaque cGAS gene in mammalian cells by retroviral transductionDepositorInsertCrab-eating macaque cGAS truncation mutant (160-522 a.a.) with C-terminal HA tag (CGAS Macaca fascicularis, Synthetic)
UseRetroviralTagsHAExpressionMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN-GFP
Plasmid#186845PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with C-terminal GFP fusion (Adamts1 Human, Synthetic)
UseRetroviralTagsGFPExpressionMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-FLAG-human cGASdeltaN-HA
Plasmid#186848PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with N-terminal FLAG and C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsFLAG and HAExpressionMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN C396/397A-HA
Plasmid#186850PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with DNA binding mutantation C396/397A) and C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAExpressionMutationN-terminal truncation, C396A, C397APromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGAS:154-522aa-HA
Plasmid#186855PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (154-522 a.a.) with C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAExpressionMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
macroH2A2-V192F-GFP (pc5116)
Plasmid#223439PurposeMutation of valine 192 to phenylalanine (V192F) in macroH2A2.DepositorUseTagsGFPExpressionMammalianMutationMutation of valine 192 to phenylalanine (V192F)PromoterCMVAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1876-AAV-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA2)
Plasmid#223162PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and gRNA2 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1298-AAV-EFSNC-dCjCas9-HP1bNH(111-173)
Plasmid#223143PurposeExpression of truncated HP1b with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 111-173PromoterEF1aAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-GFP-LA
Plasmid#206197PurposeExpresses GFP-tagged human Lamin-A protein by the constitutive CMV promoter in miceDepositorInsertLmna (LMNA )
UseAAVTagsGFPExpressionMutationPromoterCMVAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1308-AAV-EFSNC-dSaCas9-HP1bNH(111-173)
Plasmid#223153PurposeExpression of truncated HP1b with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 111-173PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1861-AAV-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA1)
Plasmid#223161PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK2046-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA1)
Plasmid#223166Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2 Triple Cryptic Cre recombinase in pTwist-CMV
Plasmid#216162PurposeExpresses Cre recombinase in cells lacking TDP-43 function. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertCre recombinase with N-terminal SV40 NLS and C-terminal c-Myc NLS
UseCre/LoxTagsExpressionMammalianMutationPromoterAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-muGFP-hATG2A mLIRΔWIR
Plasmid#215508PurposeExpresses GFP tagged human ATG2A which has the mutation in LC3 interacting region and lacks WIPI interacting region.DepositorInsertAutophagy related 2A (ATG2A Human)
UseRetroviralTagsmuGFPExpressionMammalianMutationP656R (natural variant with no functional relevan…PromoterAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-RBD Omicron XBB.1.5
Plasmid#214724PurposeExpresses SARS-CoV-2 Omicron XBB.1.5 RBD (receptor-binding domain from Spike) with N-terminal SpyTag fusion in mammalian cellsDepositorInsertReceptor-Binding Domain (S SARS-CoV-2)
UseTagsSpyTagExpressionMammalianMutationPromoterCMVAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-HF1-Hypa
Plasmid#218162PurposeThis plasmid harbors the base editor SCBE3-NG-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionTagsExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable sinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-4gRNA-GBX2-RFP
Plasmid#192288PurposeExpresses RFP and four sgRNAs against GBX2DepositorInsertRFP and four sgRNA GBX2 (GBX2 Synthetic)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-HA-Dre]-lox-Akna-mOrange2
Plasmid#196893PurposeNeuron-specific expression of Akna fused to mOrange2. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertAkna-mOrange2 (Akna Mouse)
UseCre/Lox; Dre/roxTagsExpressionMammalianMutationPromoterQuimeric CAGAvailable sinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-iCre-pA]-lox-Akna-mOrange2
Plasmid#196880PurposeNeuron-specific expression of the centrosomal protein Akna fused to mOrange2DepositorInsertAkna-mOrange2 (Akna Mouse)
UseCre/LoxTagsExpressionMammalianMutationPromoterQuimeric CAGAvailable sinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-iCre-pA]-lox-2xHA-128-425-Akap9
Plasmid#196897PurposeNeuron-specific expression of fragment 128-425 from A-Kinase Anchoring Protein 9 (Akap9) fused to 2xHA-tags.DepositorInsert2xHA-Akap9(128-425) (Akap9 Rat)
UseCre/LoxTagsExpressionMammalianMutationPromoterQuimeric CAGAvailable sinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-HA-Dre]-lox-mOrange2-NEDD1-gTBD
Plasmid#196894PurposeNeuron-specific expression of the gamma-tubulin-binding domain (gTBD) of NEDD1 fused to mOrange aimed to displace endogenous gamma-TuRC from the centrosome. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertN-gTBD-mOrange2 (NEDD1 Human)
UseCre/Lox; Dre/roxTagsExpressionMammalianMutationPromoterQuimeric CAGAvailable sinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-Dre-PA]-lox-2xHA-CAMSAP3
Plasmid#196895PurposeNeuron-specific expression of Calmodulin Regulated Spectrin Associated Protein Family Member 3 (CAMSAP3) fused to 2xHA-tags. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsert2xHA-CAMSAP3 (Camsap3 Mouse)
UseCre/Lox; Dre/roxTagsExpressionMammalianMutationPromoterQuimeric CAGAvailable sinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-mOrange2-Cdk5rap2-CTD
Plasmid#196855PurposeExpression of the centrosome targeting carboxy-terminal domain (CTD) of Cdk5rap2 fused to mOrange2. Used to displace endogenous Cdk5rap2 from centrosomes.DepositorInsertmOrange2-Cdk5rap2-CTD (Cdk5rap2 Discosoma sp.)
UseTagsExpressionMammalianMutationNone (wt)PromoterChicken bactin (plus Chicken bactin intron)Available sinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-AcGFP-Cdk5rap2-CTDdeltaCBD
Plasmid#196856PurposeExpression of the centrosome targeting carboxy-terminal domain (CTD) laking the centrosome binding domain (deltaCBD) of Cdk5rap2 fused to AcGFP. It cannot displace Cdk5rap2 from centrosomesDepositorInsertAcGFP-Cdk5rap2-CTDdeltaCBD (Cdk5rap2 Rat)
UseTagsExpressionMammalianMutationLacking the centrosome-targeting domain (CTD)PromoterChicken bactin (plus Chicken bactin intron)Available sinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-Myc-PSK2 (1-416) (K57A)
Plasmid#197124PurposeExpression of kinase-deficient Myc-tagged PSK2 (aa1-416, K57A) / TAOK1 (aa1-416, K57A) in mammalian cellsDepositorInsertTAOK1 (aa1-416, K57A) (TAOK1 Human)
UseTagsMycExpressionMammalianMutationChanged K 57 to A and deleted C-terminusPromoterSV40Available sinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-F479L
Plasmid#195477PurposepInducer21 plasmid containing the human MEFV gene with the F479L mutation (associated with Familial Mediterranean Fever) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationchanged phenylalanine 479 to leucinePromoterAvailable sinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-ΔPYD
Plasmid#195478PurposepInducer21 plasmid containing the human MEFV gene with a deletion of residues 1 - 92 (the resulting pyrin protein lacks the PYD domain) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationdeletion of residues 1-92 of pyrin (the PYD domai…PromoterAvailable sinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer21-3xFlag-hMEFV-Q426R
Plasmid#195475PurposepInducer21 plasmid containing the human MEFV gene with the Q426R mutation (associated with Familial Mediterranean Fever) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationchanged glutamine 426 to argininePromoterAvailable sinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-S580X
Plasmid#195474PurposepInducer21 plasmid containing the human MEFV gene with the S580X mutation (stop codon leading to the truncation of the B30.2 domain of the pyrin protein) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationchanged S580 to a stop codonPromoterAvailable sinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLED.CaRPv1
Plasmid#193018PurposeExcitatory/Inhibitory neuron calcium indicator (hSyn promoter, Synrg exon, jRGECO1a/jGCaMP7b)DepositorInsertBichromatic calcium indicator (jGCaMP7b and jRGECO1a)
UseAAVTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLED.RAB
Plasmid#193015PurposePhotoreceptor-specific reporter (CBh promoter, Atp1b2 exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
IL2-mCherry-AHA740D, E758K in pmCherryN1
Plasmid#187285PurposeExpress IL2-AH A740D, E758K-mCherryDepositorUseTagsmCherryExpressionMammalianMutationAH A740D, E758KPromoterCMVAvailable sinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E7-D192D
Plasmid#154024PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 7 c.576C>T, p.D192D (Synonymous Mutation)DepositorInsertBAP1 Exon 7 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.576C>T, p.D192DPromoterAvailable sinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E11-G312G
Plasmid#154026PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 11 c.936T>G, p.G312G (Synonymous Mutation)DepositorInsertBAP1 Exon 11 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.936T>G, p.G312GPromoterAvailable sinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-shRPS6
Plasmid#125780Purposeconstitutive expression of a short-hairpin RNA targeting human RPS6 (RNAi positive control)DepositorInsertshRPS6 (RPS6 Human)
UseRNAiTagsExpressionMutationPromoterAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only