We narrowed to 5,500 results for: crispr cas9 grna plasmid
-
Plasmid#113620PurposesgRNA/CAS9 expression plasmid to induce the 5’ double-strand break in both the EJ7-GFP and 4-μHOM reportersDepositorInsert7a sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Sa-SchCas9
Plasmid#192137PurposeExpresses Sa-SchCas9, and cloning backbone for sgRNADepositorInsertSa-SchCas9
UseAAVExpressionMammalianAvailable SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Sha3Cas9
Plasmid#192136PurposeExpresses Sha3Cas9, and cloning backbone for sgRNADepositorInsertSha3Cas9
UseAAVExpressionMammalianAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-1- LentiCRISPRv2
Plasmid#107403PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-2- LentiCRISPRv2
Plasmid#107404PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sha2Cas9-HF
Plasmid#192142PurposeExpresses highly specific Sha2Cas9, and cloning backbone for sgRNADepositorInsertSha2Cas9-HF
UseAAVExpressionMammalianMutationSha2Cas9-HF (R247A and N415A)Available SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459_V2.0_pSpCas9(BB)-2A-Puro_T-REX17_Ex1_KI
Plasmid#195504PurposeCas9-2A-Puro expression vector bearing a sgRNA targeting Exon 1 of human lncRNA T-REX17DepositorInsertsgRNA
UseCRISPRTags3XFLAG, Puro, and T2AExpressionMammalianPromoterU6Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT6)
Plasmid#236203Purposelentiviral expression of Cas9 and encodes CT6 sgRNA for CLEC12A deletionDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT44)
Plasmid#236204Purposelentiviral expression of Cas9 and encodes CT44 sgRNA for CLEC12A deletionDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT47)
Plasmid#236205Purposelentiviral expression of Cas9 and encodes CT47 sgRNA for CLEC12A deletionDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_PHF19_sgRNA
Plasmid#246404PurposeCas9/sgRNA expression plasmid targeting PHF19DepositorInsertPHF19 (PHF19 Human)
ExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_MTF2_sgRNA
Plasmid#246402PurposeCas9/sgRNA expression plasmid targeting MTF2DepositorInsertMTF2 (MTF2 Human)
ExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1651-sgRNA(F+E)-sgGal4
Plasmid#100549PurposesgGal4-expressing vector modified from Addgene plasmid #51024DepositorInsertsgGal4
UseCRISPRTagssgRNAExpressionMammalianPromoterU6Available SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sasgRNACMV- mCherry-WPREpA
Plasmid#217015PurposeS. aureus sgRNAs backbone along with mCherry expressionDepositorInsertmCherry
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_YES_i2
Plasmid#231419PurposeThis YES-gate plasmid expresses dCas9 from a constitutive promoter, GFP from a promoter repressible by sgRNA-Y, and sgRNA-Y repressible by sgRNA-2.DepositorInsertsdCas9
GFP
sgRNA-Y
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only