We narrowed to 7,283 results for: ust
-
Plasmid#224297PurposeExpresses estrogen receptor linked KLF2 and mCherry under EF1a promoterDepositorInsertEstrogen Receptor linked KLF2 T2A mCherry (Klf2 Mouse)
UseRetroviralTagsEstrogen ReceptorExpressionMammalianPromoterEF1aAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn T21R(I18R+M72E)-F8.2(S54L+T127A)-T2A-mCherry
Plasmid#225591PurposeAAV transgene plasmid with hSyn promoter for expression of catalytically dead TRIM21 RING(I18R+M72E)-F8.2(S54L+T127A) anti-tau degrader with a self-cleaving T2A-mCherry fluorescent expression reporterDepositorInsertT21R(I18R+M72E)-F8.2(S54L+T127A)-T2A-mCherry
UseAAVTagsmCherryExpressionMammalianPromoterhSynAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron3_sg4_pX458
Plasmid#127339PurposesgRNA that cuts within intron 3 of mouse CDK13 genomic locus- guide #4DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron4_sg3_pX330
Plasmid#127340PurposesgRNA that cuts within intron 4 of mouse CDK13 genomic locus- guide #3DepositorInsertMouse Cdk13 Intron 4 Targeting sgRNA (Cdk13 Mouse)
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk13_Untagged
Plasmid#127342PurposeUntagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into Gateway entry vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UseEntry vector with transgene for gateway cloningMutationBase pairs 1-1554 of transgene are codon optimize…PromoterNoneAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-SOX2-3xHA-P2A-tagBFP
Plasmid#163701PurposeDox-inducible SOX2-3xHA HDR knock-in cassette into the AAVS1 locus with a tagBFP fluorescent marker linked by a self-cleaving P2A peptide.DepositorInsertsUseAAV and CRISPRTags3x-HA and P2A-tagBFPExpressionMammalianPromoterCAG and TRE3GAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTT3-ecdCD80-ST3-His
Plasmid#210665PurposeExpression of the extracellular domain of human CD80 fused to Spytag003 + Histag in HEK293 (or similar)DepositorInsertExtracellular domain of human CD80 fused to Spytag003 and Histag (CD80 Human)
TagsHistag and Spytag003ExpressionMammalianPromoterCMVAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV21 [pSNG-1::SNG-1::CRY2(D387A)olig(535)::SL2::mCherry]
Plasmid#197599PurposePan-neuronal expression of SNG-1::CRY2(D387A)olig(535) in neurons of C. elegans. CRY2(D387A) is photoinactiveDepositorExpressionWormMutationD387A, E490GAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-FnCas9ABEmax8.17d
Plasmid#201955PurposeMammalian expression plasmid of FnCas9ABEmax8.17d base editor with T2A-EGFP and cloning backbone for sgRNADepositorInsertbpNLS-FnCas9ABEmax8.17d-bpNLS-3xHA-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationD11A on FnCas9, V82S, V106W, Q154R on mutant TadAPromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCI AscI MR1 res
Plasmid#214752Purposeexpresses human MR1 resistant to CRISPR editing with a specific sgRNA in mammalian cellsDepositorInsertMHC class I-related protein 1 (MR1 Human)
TagsIRES eGFPExpressionMammalianMutationsilent mutations to prevent editing by CRISPR/Cas…PromoterCMVAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHIP2-ΔPR1
Plasmid#214902Purposeexpression of the truncated variants of the SHIP2 without first proline-rich domainDepositorInserthuman SHIP2 delta aa 123-410 (INPPL1 Human)
TagsV5/HisExpressionMammalianMutationdelta 123-410aaPromoterCMVAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHIP2-C2
Plasmid#214906Purposeexpression of the truncated variants of the SHIP2 that retains second proline-rich domainDepositorInserthuman SHIP2 aa 740-1189 (INPPL1 Human)
TagsV5/HisExpressionMammalianMutationdelta 1-739, 1190-1258aaPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHIP2-C1
Plasmid#214905Purposeexpression of the truncated variants of the SHIP2 that retains second proline-rich domain and C-terminal sterile alpha motifDepositorInserthuman SHIP2 aa 740-1258 (INPPL1 Human)
TagsV5/HisExpressionMammalianMutationdelta 1-739aaPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHIP2-N2
Plasmid#214904Purposeexpression of the truncated variants of the SHIP2 that retains first proline-rich domainDepositorInserthuman SHIP2 aa 123-418 (INPPL1 Human)
TagsV5/HisExpressionMammalianMutationdelta 1-122, 419-1258aaPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHIP2-N1
Plasmid#214903Purposeexpression of the truncated variants of the SHIP2 that retains only SH2 domain and first proline-rich domainDepositorInserthuman SHIP2 aa 1-418 (INPPL1 Human)
TagsV5/HisExpressionMammalianMutationdelta 419-1258aaPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PCRbluntII-pHES7-STOPgRNA
Plasmid#204349PurposegRNA to target pig HES7 stop codonDepositorInsertPig HES7-STOP-gRNA (HES7 Sus domesticus (pig))
ExpressionMammalianAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:NEAT1-total_SigP:NLuc
Plasmid#197267PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human NEAT1 locus (both isoforms). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertNEAT1-total homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only