We narrowed to 11,082 results for: CHL
-
Plasmid#148696PurposeBacterial Expression of DmNot4_813-836opt-L828EDepositorInsertDmNot4_813-836opt-L828E (CG31716 Synthetic)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpH-CeeIF4E3_1-215opt_AB
Plasmid#148367PurposeBacterial Expression of CeeIF4E3_1-215DepositorInsertCeeIF4E3_1-215
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpH-CeeIF4E3_30-215opt_AB
Plasmid#148369PurposeBacterial Expression of CeeIF4E3_30-215optDepositorInsertCeeIF4E3_30-215opt
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NpM-HsNot7-D40AE42A_AF
Plasmid#148675PurposeBacterial Expression of HsNot7-D40AE42ADepositorInsertHsNot7-D40AE42A (CNOT7 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB2890
Plasmid#193133PurposeA2 Proximal promoter sequence consisting of the target sequence for the gRNA1 (GB1838) at "d site" (-120 from TSS) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1dG2b.1
UseSynthetic BiologyAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::HA-RfA
Plasmid#186404PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of N-ter HA tag and a gene of interest under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::HA-RfA
Plasmid#186411PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion N-ter HA tag-gene of interest under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::venus-RfA
Plasmid#186408PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion gene of interest-C-ter Venus under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA-CFP
Plasmid#186412PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion gene of interest-C-ter CFP under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
PDEST-pSP172BSSPE-pFOGc::RfA-ECFP
Plasmid#186403PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter ECFP under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::RfA-ECFP
Plasmid#186402PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter eCFP under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-pFOGc::RfA-venus
Plasmid#186401PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter Venus under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-pFOGc::venus-RfA
Plasmid#186400PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of N-ter Venus and a gene of interest under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::venus-RfA
Plasmid#186398PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of N-ter Venus and a gene of interest under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTE1069
Plasmid#186629PurposeSCB-GFP E. coli reporter plasmid. Encodes repressor ScbR and ScbAp promoter upstream of GFP.DepositorInsertsscbR
scbAp promoter
UseSynthetic BiologyTags6xArgExpressionBacterialPromoterBBa_J23100 and scbApAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::RfA-HA
Plasmid#186405PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter HA tag under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA-venus
Plasmid#186409PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion N-ter Venus-gene of interest under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA-HA
Plasmid#186410PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion gene of interest-C-ter HA tag under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEM264 - pDESTR4-R3 mosTI Pmlc-2_GFP target
Plasmid#159842PurposeSingle copy or array insertion by MosTI using split Pmlc-2 GFP selectionDepositorInsertpDESTR4-R3 mosTI Pmlc-2_GFP target
ExpressionWormMutationNot applicableAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_009
Plasmid#180518PurposeEmpty backbone for D1.1 cloning, contains LacZ dropoutDepositorTypeEmpty backboneExpressionBacterialAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_137
Plasmid#180521PurposeEmpty backbone for D1.2 cloning, contains sfGFP dropoutDepositorTypeEmpty backboneExpressionBacterialAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_010
Plasmid#180519PurposeEmpty backbone for D1.2 cloning, contains LacZ dropoutDepositorTypeEmpty backboneExpressionBacterialAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJAK175
Plasmid#178601PurposepAP259 derived plasmid encoding a xylose inducible BitlucOptDepositorInsertBitlucopt
ExpressionBacterialPromoterPxylAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pMC6-spacer
Plasmid#176178Purposeyeast MoClo level-0 part plasmid type 6 containing non-coding DNA spacer for construction of MoClo plasmids without yeast markerDepositorInsert41 bp non-coding DNA spacer from pYTK048
UseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-xylA
Plasmid#158611PurposeLow phosphate inducible gRNA silencing the xylA promoterDepositorInsertxylA guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-udhA-xylA
Plasmid#158612PurposeLow phosphate inducible gRNA array to silence the xylA and udhA promotersDepositorInsertudhA-xylA guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA2-xylA
Plasmid#158613PurposeLow phosphate inducible gRNA array to silence the xylA and gltA2 promotersDepositorInsertgltA2-xylA guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-zwf-xylA
Plasmid#158614PurposeLow phosphate inducible gRNA array to silence the xylA and zwf promotersDepositorInsertzwf-xylA guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0776
Plasmid#177066PurposeMoClo Level 1, position 2, transcriptional unit for transient expression of strictosidine synthase (CrSTR) from Catharanthus roseus driven by 35S promoter; contains a chloroplast transit peptideDepositorInsertstrictosidine synthase (CrSTR) from Catharanthus roseus
UseSynthetic BiologyAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0774
Plasmid#177064PurposeMoClo Level 1, position 1, transcriptional unit for transient expression of tryptophan decarboxylase (CrTDC) from Catharanthus roseus driven by 35S promoter; contains a chloroplast transit peptideDepositorInserttryptophan decarboxylase (CrTDC) from Catharanthus roseus
UseSynthetic BiologyAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0772
Plasmid#177062PurposeMoClo Level 1, position 6, transcriptional unit for transient expression of secologanin synthase (CrSLS1) from Catharanthus roseus driven by 35S promoter; contains a chloroplast transit peptideDepositorInsertsecologanin synthase (CrSLS1) from Catharanthus roseus
UseSynthetic BiologyAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0122
Plasmid#177054PurposeMoClo Level 1, position 2, transcriptional unit for transient expression of iridoid oxidase; CYP76A26 (CrIO) from Catharanthus roseus driven by 35S promoter; contains a chloroplast transit peptideDepositorInsertiridoid oxidase; CYP76A26 (CrIO) from Catharanthus roseus
UseSynthetic BiologyAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0118
Plasmid#177050PurposeMoClo Level 1, position 6, transcriptional unit for transient expression of iridoid synthase (CrISY) from Catharanthus roseus driven by 35S promoter; contains a chloroplast transit peptideDepositorInsertiridoid synthase (CrISY) from Catharanthus roseus
UseSynthetic BiologyAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0116
Plasmid#177048PurposeMoClo Level 1, position 5, transcriptional unit for transient expression of 8-hydroxygeraniol oxidoreductase (CrGOR) from Catharanthus roseus driven by 35S promoter; contains a chloroplast transit peptideDepositorInsert8-hydroxygeraniol oxidoreductase (CrGOR) from Catharanthus roseus
UseSynthetic BiologyAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0114
Plasmid#177046PurposeMoClo Level 1, position 4, transcriptional unit for transient expression of geraniol 8-oxidase (CrG8H) from Catharanthus roseus driven by 35S promoter; contains a chloroplast transit peptideDepositorInsertgeraniol 8-oxidase (CrG8H) from Catharanthus roseus
UseSynthetic BiologyAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
PROM5_MpU6
Plasmid#136120PurposeMp U6 promoter (type III RNA polymerase promoter) to drive expression of gRNA for CRISPR/Cas9DepositorInsertPROM5_MpU6
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
CDS_Cas9-NLS
Plasmid#136121PurposePuchta Arabidopsis codon-optimised Cas9 for CRISPRDepositorInsertCDS_AtcoCas9-NLS
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
CDS12-MpER-Targ
Plasmid#136094PurposeCDS12 with ER targeting peptide to fuse with CTAG containing HDEL ER retention signal at the 3'endDepositorInsertER targeting peptide from predicted chitinase Mapoly0069s0092
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
CTAG_eGFP-GHtag-HDEL
Plasmid#136096PurposeFP with ER retention signal for C-term fusion with CDS12 with ER targeting signal peptide. Contains Gly-His tagDepositorInsertCTAG_eGFP(noATG,noStop)-3xGly5xHys-HDEL
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUAP12008
Plasmid#177036PurposeLevel 0 promoter and 5'UTR part for MoClo assembly, GGAG-CCATDepositorInsertCauliflower Mosaic Virus (CaMV) 35S promoter and Tobacco Mosaic Virus (TMV) omega 5' UTR
UseSynthetic BiologyAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0061
Plasmid#177026PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsertiridoid oxidase; CYP76A26
UseSynthetic BiologyMutationamplified from cDNA, contains T359S relative to K…Available SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
PdnaK-IR3 GFP pZa
Plasmid#170084PurposeGFP expression under the control of E. coli dnaK promoter engineered with IR3 HAIR motif from M. tuberculosisDepositorInsertGreen fluorescent protein
UseSynthetic BiologyExpressionBacterialPromoterPdnaK-IR3Available SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRMCE{PuroR-5FCS-GMRWhite}-Vasa-FC31
Plasmid#165888PurposePuromycin resistant FC31 integrase mediated RMCE cassette for upgrading MiMic insertionsDepositorInsertAll-in-one FC31 RMCE Cassette
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRMCE{BlastR-5FCS-GMRWhite}-Vasa-FC31
Plasmid#165889PurposeBlasticidin resistant FC31 integrase mediated RMCE cassette for upgrading MiMic insertionsDepositorInsertAll-in-one FC31 RMCE Cassette
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
P[acman]-Omega1
Plasmid#165860PurposeOmega1 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
PdnaK-IR2 GFP pZa
Plasmid#170081PurposeGFP expression under the control of E. coli dnaK promoter engineered with IR2 HAIR motif from M. tuberculosisDepositorInsertGreen fluorescent protein
UseSynthetic BiologyExpressionBacterialPromoterPdnaK-IR2Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLyGo-Bs-4
Plasmid#163142PurposepLyGo cloning vector for a sequence of interest (LPMO) in B. subtilis. Vector encoding the BatLPMO10 signal peptide and the LyGo cassette (SapI-ccdB-SapI)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialPromoterPamyL-PamyQ-PcryIIIA-cryIIIAstab49Available SinceJuly 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLyGo-Bs-3
Plasmid#163141PurposepLyGo cloning vector for a sequence of interest (LPMO) in B. subtilis. Vector encoding the AprE signal peptide and the LyGo cassette (SapI-ccdB-SapI)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialPromoterPamyL-PamyQ-PcryIIIA-cryIIIAstab49Available SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only