We narrowed to 26,846 results for: GFP
-
Plasmid#188540PurposeHomologous recombination donor plasmid for CRISPR/Cas9 targeting of GFP fusion protein to the stop codon of endogenous human ABCA3 gene locusDepositorInsertEGFP
UseCRISPR; Donor for homologous recombinationAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-nE-mHP1alpha
Plasmid#181895PurposeFluorescently tagged HP1alpha, serines in N-terminal extension (NTE) replaced by glutamatesDepositorInsertnE-mHP1alpha (Cbx5 Mouse)
TagsGFPExpressionMammalianMutationS11E, S12E, S13E, S14EPromoterCMVAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
R6K_BAD_GFP-mCherry_ChInt++
Plasmid#187393Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette encoding for arabinose-inducible GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
R6K_BAD_GFP-mCherry_ChInt--
Plasmid#187394Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette encoding for arabinose-inducible GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
R6K_BAD_mCherry-GFP_ChInt--
Plasmid#187396Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette encoding for arabinose-inducible GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP10CF72 (B11)
Plasmid#185859PurposeTesting the SkGAL2 promoter inserted with 2 PZ4 element using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2M3(2*PZ4)>(BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-eGFP-P(11)4
Plasmid#185786PurposeEncodes enhanced green fluorescent protein linked to P(11)4 self-assembling peptide via a GS-linker sequenceDepositorInserteGFP-P(11)4
TagsHis-tagExpressionBacterialPromoterT7Available SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti_EGFP-P2A_truncHaus6_IRES_Blast
Plasmid#182885PurposeTransfer vector for production of lentivirus. Control plasmid for rescue experiment of HAUS6 depletion phenotype, containing a nonsense mutation and a truncation in HAUS6.DepositorInsertHAUS 6 (HAUS6 Human)
UseLentiviralExpressionBacterial and MammalianMutationstop codon introduced 2 amino acids downstream of…PromoterEF1alpha coreAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22UbGfpnE4PCh(#301)
Plasmid#184066Purposecyclofen-inducible GFP nuclear relocation in zebrafish permanent transgenicDepositorInserteGFP-nls-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)MutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-HsSyx3
Plasmid#179289PurposeE. coli expression plasmid (T7 promoter) for expression-optimized DNA of human Syx (aa 393-792) with N-terminal His6 + GFP + TEV protease cleavage siteDepositorInsertSyx
TagsHis6 + GFP + TEV protease cleavage siteExpressionBacterialMutationresidues 393-792 from accession number NP_0010361…PromoterT7Available SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-(L)-mApple
Plasmid#182856PurposeHetero-dimer expression vectorDepositorInsertmEGFP-mApple
ExpressionMammalianAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-Ub-VPS13D
Plasmid#176462Purposeexpressing GFP-Ub marked VPS13D in mammalian cells. GFP-Ub will be cleaved by DUBs to express untagged VPS13DDepositorAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-CAAAG
Plasmid#170096PurposedeGFP reporter plasmid with CAAAG PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-CAATG
Plasmid#170097PurposedeGFP reporter plasmid with CAATG PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-GTAAT
Plasmid#170098PurposedeGFP reporter plasmid with GTAAT PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-GTATT
Plasmid#170099PurposedeGFP reporter plasmid with GTATT PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-ATAAC
Plasmid#170095PurposedeGFP reporter plasmid with ATAAC PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
CTAG_eGFP-HDEL
Plasmid#136097PurposeFP with ER retention signal for C-term fusion with CDS12 with ER targeting signal peptideDepositorInsertCTAG_eGFP(noATG,noStop)-HDEL
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
FKBP-ST*-GFP
Plasmid#163669PurposeExpresses FKBP tagged partial length ST in mammalian cellsDepositorInsertpartial length ST6 beta-galactoside alpha-2,6-sialyltransferase 1 (first 113 amino acids) (ST6GAL1 Human)
TagsFK506 binding protein (FKBP) and GFPExpressionMammalianMutationThis chimera contains the first 113 amino acids o…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only