We narrowed to 5,500 results for: crispr cas9 grna plasmid
-
Plasmid#223141PurposeExpression of truncated HP1a with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1a (CBX5 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 115-177PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1309-AAV-EFSNC-dSaCas9-MBD1(529-592)
Plasmid#223154PurposeExpression of truncated MBD1 with dSaCas9 and empty gRNA scaffoldDepositorInsertMBD1 (MBD1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 529-592PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1313-AAV-EFSNC-dSaCas9-MECP2(204-310)
Plasmid#223158PurposeExpression of truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertMECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1310-AAV-EFSNC-dSaCas9-MBD2(176-231)
Plasmid#223155PurposeExpression of truncated MBD2 with dSaCas9 and empty gRNA scaffoldDepositorInsertMBD2 (MBD2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 176-231PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_PHF1_sgRNA
Plasmid#246403PurposeCas9/sgRNA expression plasmid targeting PHF1DepositorInsertPHF1 (PHF1 Human)
ExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACT1:Cas9-GFP, U6:sgTK
Plasmid#122852PurposeExpresses Cas9 fused with GFP and a sgRNA targeting the Cryptosporidium parvum TK geneDepositorInsertsCas9-GFP
U6-sgTK
UseCRISPR; Cas9-gfp plasmid for genome editing of cr…TagseGFPPromoterCryptosporidium parvum U6 and Cryptosporidium par…Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pACT1:Cas9-GFP, U6:sgUPRT
Plasmid#122853PurposeExpresses Cas9 fused with GFP and a sgRNA targeting the Cryptosporidium parvum UPRT geneDepositorInsertsCas9-GFP
U6-sgUPRT
UseCRISPR; Cas9-gfp plasmid for genome editing of cr…TagseGFPPromoterCryptosporidium parvum U6 and Cryptosporidium par…Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SauriCas9
Plasmid#135964PurposeExpresses SauriCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Sa-SauriCas9
Plasmid#135967PurposeExpresses Sa-SauriCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-DIO-SaCas9-U6-sgGabbr1
Plasmid#240044PurposeKnockdown expression of Gabbr1DepositorInsertgamma-aminobutyric acid type B receptor subunit 1 (Gabbr1 Mouse)
UseAAV, CRISPR, and Mouse TargetingPromoterCMVAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-en31FnCas9ABEmax8.17d
Plasmid#201956PurposeMammalian expression plasmid of en31FnCas9ABEmax8.17d base editor with T2A-EGFP and cloning backbone for sgRNADepositorInsertbpNLS-en31FnCas9ABEmax8.17d-bpNLS-3xHA-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianPromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-dSpCas9
Plasmid#201953PurposeMammalian expression plasmid of dead SpCas9 with T2A-EGFP and cloning backbone for sgRNADepositorInsert3xHA-NLS-dSpCas9-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationD10A and H840A on SpCas9PromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ABE-NT-sgRNA
Plasmid#112734PurposeAAV inverted terminal repeat based vector plasmid encoding E. coli TadA, the N-terminal half of nCas9 and sgRNADepositorInsertABE-NT-sgRNA
UseAAVAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-GFP (PX458)
Plasmid#129025Purposetargeted DNA demethylation, expression of dCas9-huTET1CD-T2A-EGFP and cloning backbone for sgRNADepositorInsertdCas9-huTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-EGFPExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)
Plasmid#129027Purposetargeted DNA demethylation, expression of dCas9-huTET1CD-T2A-mCherry and cloning backbone for sgRNADepositorInsertdCas9-huTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-sgCTRL
Plasmid#209750PurposeLentiviral transfer plasmid to express Cas9 and a control, non-specific gRNA (does not target any human gene)DepositorInsertCas9
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only