We narrowed to 4,117 results for: SPL
-
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1AUC-DelStem-CD20-Puro
Plasmid#209758PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1; variant 1 mRNA isoform with mutations to disrupt the uORFs and the stem-loop within the 5'-UTR.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationMutations to disrupt the uORFs and the stem-loop …Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-AVPR2-NTEV-TCS-GV-2xHA
Plasmid#194371PurposeSplit TEV assaysDepositorInsertSP-AVPR2-NTEV-TCS-GV-2xHA (AVPR2 Human, Synthetic)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_AVPR2-V2R-NTEV-TCS-GV-2xHA
Plasmid#194372PurposeSplit TEV assaysDepositorInsertAVPR2-V2R-NTEV-TCS-GV-2xHA (AVPR2 Human, Synthetic)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-DRD1-V2R-NTEV-TCS-GV-2xHA
Plasmid#194361PurposeSplit TEV assaysDepositorInsertSP-DRD1-V2R-NTEV-TCS-GV-2xHA (DRD1 Human, Synthetic)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-C-SH2
Plasmid#111419Purposeexpress murine Syk (C)SH2 domain (His 162 to Gln 264), in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk (C)SH2 domain (His 162 to Gln 264), without any tag (Syk Mouse)
ExpressionBacterialPromoterT7 promoterAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-N-SH2+IA
Plasmid#111273Purposeexpress murine Syk (N)SH2 domain plus interdomain A (Ser 8 to His 162), with an N-terminal (His)6 tag and TEV cleavage site, in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk (N)SH2 domain plus interdomain A (Ser 8 to His 162), with an N-terminal (His)6 tag and TEV cleavage site (Syk Mouse)
TagsHHHHHHENLYFQGExpressionBacterialPromoterT7 promoterAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_K36E_R38E
Plasmid#65095PurposeDestination vector with RBPMS with K36E/R38E mutation for stable cell line generationDepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchange lysine 36 to glutamic acid and arginine 38…PromoterCMV, 2x TetAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO myc Separase delta 55/Non-Cleavable
Plasmid#59827PurposeAllows the integration of myc Separase delta 55/Non-Cleavable in the genome and Tet-inducible expression.DepositorInsertSeparase (ESPL1 Human)
TagsMycExpressionMammalianMutationdelta 55/Non-Cleavable (E1483R, R1486E, E1503R, R…Promoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 3xFLAG TPP1 88-249 delta166-172
Plasmid#53550Purposemammalian expression of TPP1 OB-fold domain with 166-172 replaced with "GSSG"DepositorInsertTPP1 (ACD Human)
Tags3xFLAGExpressionMammalianMutationcontains aa 88-249, with aa 166-172 replaced with…PromoterCMVAvailable SinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNTPTP alpha (S204A)
Plasmid#17699DepositorAvailable SinceApril 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
pRP[CRISPR]-EGFP/Puro-hCas9-U6>(long left)-U6>(long right)
Plasmid#216871PurposeThis plasmid contains hCas9 and two gRNAs that can excise the genomic area around the mouse mdx mutation in dystrophin's exon 23DepositorInsertCas9, gRNA Long.L, gRNA Long.R (Dmd Mouse)
UseCRISPRMutationmdx mutation in mouse dystrophinAvailable SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-AVPR2-V2R-NTEV-TCS-GV-2xHA
Plasmid#194373PurposeSplit TEV assaysDepositorInsertSP-AVPR2-V2R-NTEV-TCS-GV-2xHA (AVPR2 Human, Synthetic)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bad-2A-pEGFP-C1
Plasmid#166748PurposeExpress Venus fused to the N-terminus of the Bcl-2 family protein, Bad with mutation to 2 positions in the BH3 domainDepositorInsertBad-2A (BAD Human)
TagsVenusExpressionMammalianMutation2 hydrophobic residues in the BH3 region mutated …PromoterCMVAvailable SinceMarch 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E7-D192D
Plasmid#154024PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 7 c.576C>T, p.D192D (Synonymous Mutation)DepositorInsertBAP1 Exon 7 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.576C>T, p.D192DAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-skywarp-CRISPR-resistant
Plasmid#134252PurposeLentivector encoding CRISPR-resistant skywarp form of Snrnp40 (missing exon 5)DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationdeleted amino acids 179-219, and mutated coding s…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-C-SH2+IA
Plasmid#111418Purposeexpress murine Syk (C)SH2 domain plus interdomain A (Phe 119 to Gln 264), in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk (C)SH2 domain plus interdomain A (Phe 119 to Gln 264), without any tag (Syk Mouse)
ExpressionBacterialPromoterT7 promoterAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMAL-MBP-FRB-KRas/N12
Plasmid#214302PurposeExpress split-KRas fragment fused with FRB and MBPDepositorInsertSplit-KRas fragment fused with FRB (KRAS Human)
TagsMaltose-binding protein (MBP)ExpressionBacterialPromoterTacAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21b-KRas/13C-FKBP-MBP
Plasmid#214303PurposeExpress split-KRas fragment fused with FKBP and MBPDepositorInsertSplit-KRas fragment fused with FKBP (KRAS Human)
TagsMaltose-binding protein (MBP)ExpressionBacterialMutationKRas-Q61LPromoterT7Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Venus-BimEL-4E-pEGFP-C1
Plasmid#166742PurposeExpress Venus fused to the N-terminus of the Bcl-2 family protein, BimEL with mutation in BH3 domain to disrupt binding anti-apoptotic proteinsDepositorInsertBimEL-4E (Bcl2l11 Mouse)
TagsVenusExpressionMammalianMutation4 hydrophobic residues in the BH3 region mutated …PromoterCMVAvailable SinceMarch 30, 2021AvailabilityAcademic Institutions and Nonprofits only